Informations

Chez les insectes, la répétition Alanine se produit-elle sur la séquence d'homéodomaine de l'abdomen ou se produit-elle sur une séquence différente ?


Par "répétition d'alanine", je fais référence à la suppression de la formation de pattes d'insectes supplémentaires en raison de la suppression du gène Ubx par une répression sans Distal.


Un peu d'arrière-plan :

Le nouveau travail impliquait une mauvaise expression de la protéine Drosophila Ubx dans le thorax présumé d'embryons de mouches des fruits transgéniques. Le développement des membres a été supprimé en raison de la répression de la Dll. En revanche, la mauvaise expression des protéines Ubx d'onychophore et de crustacé n'a pas interféré avec l'expression de Dll et la formation des membres thoraciques. Ces résultats ont soulevé la possibilité que la protéine Ubx de Drosophila soit fonctionnellement distincte de Ubx chez les onychophores et les crustacés. Une étude suggère que Drosophila Ubx a acquis un peptide riche en alanine qui médie la répression de la transcription des gènes ; ce peptide manque chez les onychophores. L'autre étude apporte la preuve que le crustacé Ubx contient un peptide supplémentaire qui module l'activité du peptide riche en alanine, et éventuellement d'autres domaines de répression, chez le crustacé Ubx.

Les séquences restreintes aux insectes comprennent quatre régions N-terminales à l'homéodomaine (I1-I4), un motif peptidique (QAQAQK) et une série étendue de résidus d'alanine C-terminale à l'homéodomaine

La protéine d'onychophore Ubx pourrait fonctionner comme un activateur du développement des appendices. Lorsque les onychophores et les arthropodes ont divergé, Ubx a acquis un domaine de répression riche en alanine près de son extrémité carboxy. Ce domaine médie la répression constitutive chez les insectes. Mais chez les crustacés, l'ajout du peptide régulateur le fait fonctionner de manière conditionnelle. En conséquence, Ubx ne supprime pas le développement des membres chez les crustacés. Mais il élimine les membres abdominaux chez les insectes, réduisant considérablement le nombre total d'appendices par rapport aux crustacés.

Vous pouvez lire à ce sujet ici:

Levine, Mike. "Biologie évolutive : comment les insectes perdent leurs membres." Nature 415.6874 (2002) : 848-849.

Galant, Ron et Sean B. Carroll. "Évolution d'un domaine de répression transcriptionnelle dans une protéine Hox d'insecte." Nature 415.6874 (2002): 910-913.


Les acides aminés en tandem se répètent dans l'anole vert (Anolis carolinensis) et d'autres squamates pourraient jouer un rôle dans l'augmentation de la variabilité génétique

Les répétitions d'acides aminés en tandem sont caractérisées par la récurrence consécutive d'un seul acide aminé. Ils présentent des taux élevés de mutations de longueur en plus des mutations ponctuelles et ont été proposés pour être impliqués dans la plasticité génétique. Les reptiles squamates (lézards et serpents) se diversifient à la fois en morphologie et en physiologie. Le mécanisme sous-jacent reste à comprendre. Dans une précédente analyse phylogénomique des reptiles, la densité des répétitions en tandem chez un lézard anole divergeait fortement de celle des autres reptiles. Pour mieux comprendre les répétitions d'acides aminés en tandem dans les squamates, nous avons analysé le contenu de répétition dans l'anole vert (Anolis carolinensis).

Résultats

Nos résultats ont révélé que le nombre de répétitions d'acides aminés dans l'anole vert dépassait ceux trouvés dans les cinq autres espèces étudiées. Des répétitions d'espèces seulement ont été trouvées en forte proportion dans l'anole vert mais pas dans les cinq autres espèces, ce qui suggère que l'anole vert avait gagné de nombreuses répétitions d'acides aminés dans les deux Anolis ou la lignée squamate. Étant donné que les gènes contenant des répétitions d'acides aminés dans l'anole vert étaient fortement enrichis en gènes liés à la transcription et au développement, une famille importante de gènes de développement, c'est-à-dire la famille Hox, a été étudiée plus avant dans une large collection de squamates. Des répétitions abondantes d'acides aminés ont également été observées, ce qui implique la haute tolérance générale des répétitions d'acides aminés dans les squamates. Un enrichissement particulier des répétitions d'acides aminés a été observé dans les gènes de la classe centrale Hox qui sont connus pour être responsables de la définition des régions cervicale à lombaire.

Conclusion

Notre étude suggère que les répétitions abondantes d'acides aminés dans l'anole vert, et peut-être dans d'autres squamates, pourraient jouer un rôle dans l'augmentation de la variabilité génétique et contribuer à la diversité évolutive de ce clade.


Reconnaissance du non-soi

Les réactions immunitaires sont déclenchées lorsque des molécules d'origine microbienne sont détectées et reconnues comme « non-soi ». Cette étape de reconnaissance implique des récepteurs de reconnaissance de motifs (PRR) qui reconnaissent et se lient aux motifs moléculaires dits pathogènes associés (PAMP) qui sont partagés par divers micro-organismes mais absents des cellules eucaryotes (Medzhitov et Janeway, 1997b, 2002). Les PAMP qui sont connus pour être de puissants éliciteurs immunitaires comprennent les lipopolysaccharides (LPS), le peptidoglycane (PGN) et les -1,3-glucanes. Divers PRR ont été identifiés et isolés chez les vertébrés (Holmskov et al., 2003 Takeda et al., 2003) et les invertébrés (Gobert et al., 2003 Hoffmann, 2003 Wilson et al., 1999 Yu et al., 2002). Les PRR d'invertébrés les mieux étudiées sont les protéines de reconnaissance du peptidoglycane (PGRP) et les protéines de liaison aux bactéries Gram-négatives (GNBP). Les PGRP sont des protéines solubles ou transmembranaires contenant un domaine similaire au domaine de l'amidase bactérienne, qui est impliqué dans le recyclage des fragments de paroi cellulaire bactérienne. Les PGRP ont été isolés à la fois chez les invertébrés et les vertébrés (Dziarski et al., 2003 Wang et al., 2003). Le premier a été isolé de l'hémolymphe du papillon Bombyx mori, où il est impliqué dans l'activation de la cascade de la prophénoloxydase (PPO) (Yoshida et al., 1996). Dans Drosophile, trois PGRP ont été identifiés comme authentique PRR. Le PGRP-SA soluble active la voie Toll en réponse à une infection bactérienne à Gram positif (Gobert et al.,2003 Michel et al.,2001) de concert avec un autre PRR, GNBP1. En revanche, PGRP-LC (Choe et al., 2002 Gottar et al., 2002 Ramet et al., 2002) et PGRP-LE (Takehana et al., 2002) sont impliqués dans l'activation de la voie d'immunodéficience (IMD) chez réponse aux infections bactériennes à Gram négatif. Parmi les sept putatifs identifiés Anophèle PGRPs (Christophides et al., 2002), PGRPLC semble jouer un rôle central dans la défense contre l'infection bactérienne (G. K. Christophides, données non publiées). Les gènes orthologues dans les deux Drosophile (Werner et al., 2003) et Anophèle(Christophides et al., 2002) subissent un épissage alternatif résultant en au moins trois isoformes distinctes. Fait intéressant, le Anophèle PGRPLC les isoformes sont régulées de manière différentielle lors d'une épreuve immunitaire, ce qui suggère que l'épissage peut être régulé par le signal immunitaire (Christophides et al., 2002). D'autre part, PGRPLB est régulée à la hausse suite à Plasmodium infection des moustiques adultes (Dimopoulos et al., 2002) et maintient une expression élevée tout au long du cycle de vie du parasite (Christophides et al., 2002).

Les GNBP ont été décrits pour la première fois dans Bombyx mori(Lee et al., 1996) et partagent une similitude de séquence significative avec la région catalytique des β-1,3- et β-1,3,1,4-glucanases bactériennes. BmLe GNBP se lie fortement à la surface des bactéries Gram-négatives et montre une régulation positive de la transcription après une provocation bactérienne (Lee et al., 1996). Les Drosophile Le GNBP1 se lie avec une grande affinité au LPS et au β-1,3-glucane (Kim et al., 2000) et, de concert avec PGRP-SA, active la voie Toll lors d'une infection par des bactéries Gram-positives (Gobert et al., 2003) . Dans A. gambiae, six putatifs PNGB ont été identifiés (Christophides et al., 2002). Parmi eux, GNBPB1 et GNBPA1 sont régulés à la hausse après Plasmodium infection, alors que seulement GNBPB1 est sensible aux bactéries (Christophides et al.,2002 Dimopoulos et al.,2002). Autre putatif Anophèle Les PRR comprennent les protéines contenant des thioesters (TEP), les protéines immunitaires riches en leucine (LRIM) et les lectines de type C (CTL). Des membres de ces familles de protéines ont récemment été impliqués dans la régulation de Plasmodium développement dans le moustique vecteur et sont discutés plus loin dans cette revue.


Résultats

Conservation des structures des gènes orthologues TpnI et TpnT chez les insectes

Nous avons utilisé le rapport précédemment D. melanogaster Séquences des gènes TpnT et TpnI (Barbas et al. 1993 Benoist et al. 1998) pour trouver des orthologues putatifs dans le Anophèle et Apis génomes. L'organisation structurelle de ces gènes a été préservée à un degré élevé chez les insectes ( fig. 1). En général, nous observons une augmentation de la taille des gènes, principalement due à l'expansion de la longueur des introns à partir du plus petit génome—178 Mb dans D. melanogaster (Adams et al. 2000)—à ceux de Anophèle et Apis qui sont presque le double de taille ( Holt et al. 2002). La localisation chromosomique n'est pas une caractéristique largement préservée chez les insectes, ni pour les gènes TpnC ( Herranz, Mateos et Marco 2005) ni pour ceux de TpnI ou TpnT. Les gènes TpnT et TpnI sont tous deux situés sur le D. melanogaster chromosome X, mais le Anophèle Le gène TpnT est localisé cytologiquement sur le bras chromosomique 2R, tandis que TpnI reste à localiser (Mongin et al. 2004).

Structures des gènes de la troponine T (en haut) et de la troponine I (en bas) chez les insectes holométaboles. Les gènes sont étiquetés avec l'abréviation binomiale à deux lettres de l'espèce. Les exons alternatifs non codants (blanc), constitutifs (gris), alternatifs (noir) ou mutuellement exclusifs (rayures diagonales) et contenant PAANGKA ou APPAEGA (rayures horizontales) sont indiqués. Les exons 6 légèrement ombrés dans TpnI n'ont pas encore été détectés dans les expériences de RT-PCR. Nombres d'exons dans Anophèle et Apis gènes ont été attribués par homologie à ceux de leur Drosophile homologues. L'ADN génomique est représenté par une ligne continue qui est donc manquante dans les séquences de gènes dérivées des données d'ADNc. L'organisation des gènes est globalement bien préservée et la taille des gènes est en corrélation avec la taille du génome de l'organisme. La principale différence concerne les séquences riches en alanine/proline dont l'exon 3 TpnI codant pour les séquences PAANGKA chez les Drosophilidae, mais pas chez les Drosophilidae. Anophèle ou Apis. Nombreuses Apis Les exons du gène TpnI codent pour une séquence contenant APPAEGA dans leur région 3'.

Structures des gènes de la troponine T (en haut) et de la troponine I (en bas) chez les insectes holométaboles. Les gènes sont étiquetés avec l'abréviation binomiale à deux lettres de l'espèce. Les exons alternatifs non codants (blanc), constitutifs (gris), alternatifs (noir) ou mutuellement exclusifs (rayures diagonales) et contenant PAANGKA ou APPAEGA (rayures horizontales) sont indiqués. Les exons 6 ombrés clairs dans TpnI n'ont pas encore été détectés dans les expériences de RT-PCR. Nombres d'exons dans Anophèle et Apis gènes ont été attribués par homologie à ceux de leur Drosophile homologues. L'ADN génomique est représenté par une ligne continue qui est donc manquante dans les séquences de gènes dérivées des données d'ADNc. L'organisation des gènes est globalement bien préservée et la taille des gènes est en corrélation avec la taille du génome de l'organisme. La principale différence concerne les séquences riches en alanine/proline dont l'exon 3 TpnI codant pour les séquences PAANGKA chez les Drosophilidae, mais pas chez les Drosophilidae. Anophèle ou Apis. Nombreuses Apis Les exons du gène TpnI codent pour une séquence contenant APPAEGA dans leur région 3'.

Nous avons cloné et séquencé les transcrits de ces gènes chez les espèces de drosophiles et Apis, en accordant une attention particulière aux exons épissés alternativement. Dans le cas de la troponine T, les exons N t à épissage différentiel sont présents chez toutes les espèces analysées, bien que dans Apis le gène TpnT montre un exon supplémentaire épissé alternativement, nommé 5'. Les Apis équivalent au diptère, l'exon 6 est divisé en cinq exons constitutifs (a, b, c, d et e). Le séquençage des transcrits a identifié une nouvelle variable exon 10, qui avait été négligée dans les études précédentes de D. melanogaster et D. virilis transcrits TpnT séquencés ( Benoist et al. 1998). La comparaison des séquences génomiques de TpnT chez les insectes a montré que deux exons différents, nommés 10A et 10B, sont présents chez toutes les espèces holométaboles. Les deux ont une longueur de 79 nt, encodant 26 aa. Une autre différence dans la structure du gène TpnT se trouve dans l'exon 11, qui code pour une longue queue polyglutamique de taille variable chez toutes les espèces de protostomes étudiées ( Benoist et al. 1998).

Les exons constitutifs et l'exon 9 du gène TpnI sont présents chez tous les insectes analysés ( fig. 1), mais l'exon 3 ne l'est pas, dans la mesure où le Drosophile les exons orthologues 2 et 4 sont fusionnés en un exon unique dans Anophèle, mais pas dans Apis là où se trouve un exon 3 plus petit, la principale variabilité de la troponine I provient d'exons 6 mutuellement exclusifs. Dans le cas d Anophèle, nous avons détecté trois variants de l'exon 6 par homologie de séquence, tandis que quatre ont été détectés dans Apis. Fait intéressant, des exons supplémentaires, que nous avons désignés H1, H2 et H3, ont été trouvés en aval de l'exon 10 dans le Apis Gène TpnI, codant pour les séquences répétitives APPAEGA (voir ci-dessous).

Variations de séquence des exons épissés alternativement dans les gènes TpnT et TpnI

Les séquences d'acides aminés des exons constitutifs de TpnT et TpnI sont conservées presque parfaitement chez les insectes. Comme le montre la figure 2UNE, même les séquences des exons épissés alternativement (3, 4 et 5) de TpnT sont bien conservées chez les Drosophilidae. Les exons 3 et 4 sont également conservés dans A. gambiae et A. mellifera tandis qu'un degré de variation plus élevé est trouvé dans l'exon 5, reflétant la distance évolutive entre ces insectes. Dans cette région, le Apis Le gène TpnT a un exon supplémentaire épissé alternativement. Les exons 3 et 4 sont clairement conservés, mais les exons 5, 5' et l'exon constitutif 6a ont des séquences très différentes, plus proches des séquences de l'orthoptère Périplanète ( Wolf 1999) et l'odonate Libellule Les exons TpnT ( Fitzhugh et Marden 1997 Marden et al. 1999, 2001) malgré la distance évolutive beaucoup plus grande de ces espèces par rapport aux insectes holométaboles.

Exons épissés alternativement dans les gènes TpnT et TpnI. (UNE) Alignement de la région 5' des transcrits de la troponine T chez les insectes. Conservation des acides aminés (•), variation silencieuse () (ADNc), variation équivalente () et une variation non équivalente () en relation avec le Drosophila melanogaster séquence sont affichées. Ces séquences, étiquetées avec les abréviations d'espèces à deux lettres et le numéro d'exon correspondant (E10A Dm signifie exon 10A dans D. melanogaster par exemple), sont conservés chez les quatre espèces de drosophiles (seule une variation silencieuse apparaît) ainsi que chez les Anophèle et Apis exons sauf l'exon 5. Le Libellule (AF133521) et Périplanète (AF133520) Les séquences TpnT (obtenues auprès de GenBank) conservent les mêmes propriétés bien que les séquences d'exons alternatives présentent des niveaux de variation plus élevés. (B) Alignement et arbre phylogénétique des séquences alternatives de l'exon 10 TpnT chez les insectes. Les branches avec des valeurs de bootstrap inférieures à 70 % ont été réduites dans cet arbre basé sur l'ADNc. La plupart des changements affectent le nombre de résidus phosphorylables, indiqué à droite de l'alignement, à l'exception de la thréonine finale conservée marquée d'un astérisque. (C) Alignement et arbre phylogénétique des séquences alternatives des exons 9 et 10 de TpnI chez les insectes. Les Haemaphysalis longicornis La séquence TpnI (AB051079), dans laquelle l'exon 9 n'a pas été décrit, a été utilisée comme groupe externe.

Exons épissés alternativement dans les gènes TpnT et TpnI. (UNE) Alignement de la région 5' des transcrits de la troponine T chez les insectes. Conservation des acides aminés (•), variation silencieuse () (ADNc), variation équivalente () et une variation non équivalente () en relation avec le Drosophila melanogaster séquence sont affichées. Ces séquences, étiquetées avec les abréviations d'espèces à deux lettres et le numéro d'exon correspondant (E10A Dm signifie exon 10A dans D. melanogaster par exemple), sont conservés chez les quatre espèces de drosophiles (seule une variation silencieuse apparaît) ainsi que chez les Anophèle et Apis exons sauf l'exon 5. Le Libellule (AF133521) et Périplanète (AF133520) Les séquences TpnT (obtenues auprès de GenBank) conservent les mêmes propriétés bien que les séquences d'exons alternatives présentent des niveaux de variation plus élevés. (B) Alignement et arbre phylogénétique des séquences alternatives de l'exon 10 TpnT chez les insectes. Les branches avec des valeurs de bootstrap inférieures à 70 % ont été réduites dans cet arbre basé sur l'ADNc. La plupart des changements affectent le nombre de résidus phosphorylables, indiqué à droite de l'alignement, à l'exception de la thréonine finale conservée marquée d'un astérisque. (C) Alignement et arbre phylogénétique des séquences alternatives des exons 9 et 10 de TpnI chez les insectes. Les Haemaphysalis longicornis La séquence TpnI (AB051079), dans laquelle l'exon 9 n'a pas été décrit, a été utilisée comme groupe externe.

Les séquences des exons TpnT mutuellement exclusifs 10A et 10B ( fig. 2B) sont également bien conservés chez les Drosophilidae. Des différences plus importantes se trouvent dans Anophèle et Apis. Des variations non équivalentes dans l'exon 10A sont également réparties dans tout l'exon, mais moins dans l'exon 10B. Fait intéressant, un nombre plus élevé de résidus de thréonine apparaît dans l'exon 10A de l'insecte que dans l'exon 10B, mais seule la dernière thréonine de l'exon 10A est conservée chez tous les insectes analysés. Drosophile Les isoformes TpnT sont facilement phosphorylées in vivo ( Domingo et al. 1998), précisément dans la séquence codée par l'exon 10A (Nongthomba et Sparrow, communication personnelle).

En ce qui concerne les gènes TpnI, les exons constitutifs sont presque strictement conservés et la séquence des exons alternatifs 9 et 10 ( fig. 2C) reflètent une situation similaire à celle des exons TpnT 10A et 10B. Même si nous savons que les séquences à épissage alternatif sont courtes, des arbres phylogénétiques basés sur la comparaison entre les séquences codées par ces exons peuvent être construits. Bien que ces informations ne soient pas suffisantes pour établir l'origine évolutive de ces exons, elles peuvent être utilisées pour détecter comment ils ont changé dans différents groupes d'insectes lorsque les données de tous les exons sont analysées ensemble. Dans les deux gènes Tpn, l'un des exons dupliqués (TpnT exon 10A et TpnI exon 9) semble être moins conservé que l'autre (TpnT exon 10B et TpnI exon 10), montrant des modèles d'évolution similaires dans chacun des trois groupes d'insectes analysés. Il est donc probable que la duplication de ces exons alternatifs TpnT et TpnI ait pu se produire à l'origine du développement de type holométabole. Conformément à cette idée, seul un seul exon TpnT 10 avec des caractéristiques de séquence intermédiaire a été trouvé dans l'hémimétabole Periplaneta americana et Libellula pulchella. De plus, un seul exon 9/10 a été trouvé dans l'arachnide Haemaphysalis longicornis Gène TpnI (You et al. 2001). Fait intéressant, l'exon 9 de TpnI chez les Drosophilidae ne contient pas de codon stop complet, qui est formé par l'épissage de son dernier nucléotide avec les deux premières bases de l'exon 10 (Barbas et al. 1993). Cette caractéristique n'est pas observée dans Anophèle ou Apis, où les codons stop et les 3′ UTR se trouvent à la fois dans les exons 9 et 10.

Les séquences de l'exon 6 mutuellement exclusives de TpnI ont également été analysées. Dans un arbre phylogénétique consensus basé sur les séquences nucléotidiques de l'exon 6 ( fig. 3UNE), les faibles valeurs de bootstrap à la base de l'arbre à insectes suggèrent une origine ancienne pour ces événements de duplication, mais l'arbre supporte une différenciation claire des exon 6a de l'exon 6b. Les exons 6b sont suffisamment variables pour être phylogénétiquement discriminants. Les exons 6a sont si différents entre eux que le Apis les exons paralogues 6a1 et 6a2 sont aussi liés les uns aux autres que leurs exons orthologues putatifs de drosophile (voir la polytomie dans la branche de l'exon 6a). La présence d'un seul exon 6a dans Anophèle et la perte du signal d'épissage du donneur canonique de l'exon 6a2 chez les Drosophilidae sont également remarquables. Dans un alignement de séquence ( fig. 3B), on peut voir que chaque Anophèle et Apis L'exon 6 est aussi étroitement lié l'un à l'autre qu'à ceux des Drosophilidae. Enfin, l'exon 3 de Drosophilidae TpnI ( fig. 4UNE) sont essentiellement des séquences riches en alanine/proline. Tous montrent le motif PAANGKA qui apparaît répété plusieurs fois à différentes positions dans le D. melanogaster, D. subobscura, et D. virilis prolongements. Ce domaine est absent dans Anophèle et en Apis TpnIs, où se trouve un exon constitutif 3 très court.

Arbre phylogénétique et alignement des exons 6 de TpnI à épissage différentiel. (UNE) Les branches avec des valeurs de bootstrap inférieures à 70 % ont été réduites dans cet arbre basé sur l'ADNc. Les exons 6b1 et 6b2 sont clairement séparés, mais une phylogénie de l'exon 6a ne peut pas être extraite de l'arbre. (B) Alignement des séquences traduites de l'exon 6 (34 aa traduites du dernier nucléotide de l'exon 5 plus les nucléotides de l'exon 6), flanquées des séquences d'épissage lorsqu'elles sont disponibles. Les séquences sont désignées par l'abréviation d'espèce à deux lettres et le numéro d'exon correspondant (Dm E6b1 par exemple). Les exons 6a sont les plus variables, ayant même perdu la séquence canonique du donneur d'épissage (lettres en gras et en italique sur la figure) dans les exons 6a2 du drosophile.

Arbre phylogénétique et alignement des exons 6 de TpnI à épissage différentiel. (UNE) Les branches avec des valeurs de bootstrap inférieures à 70 % ont été réduites dans cet arbre basé sur l'ADNc. Les exons 6b1 et 6b2 sont clairement séparés, mais une phylogénie de l'exon 6a ne peut pas être extraite de l'arbre. (B) Alignement des séquences traduites de l'exon 6 (34 aa traduites du dernier nucléotide de l'exon 5 plus les nucléotides de l'exon 6), flanquées des séquences d'épissage lorsqu'elles sont disponibles. Les séquences sont désignées par l'abréviation d'espèce à deux lettres et le numéro d'exon correspondant (Dm E6b1 par exemple). Les exons 6a sont les plus variables, ayant même perdu la séquence canonique du donneur d'épissage (lettres en gras et en italique sur la figure) dans les exons 6a2 du drosophile.

Alignement des extensions troponine I et tropomyosine alanine/proline spécifiques à l'IFM. (UNE) Bien que les séquences de l'exon 3 TpnI ne soient pas parfaitement conservées même chez les Drosophilidae, l'heptade PAANGKA (boîte ombrée) est conservée. Il se répète chez certaines espèces entourées d'une région riche en alanine/proline. Cette séquence est absente dans Anophèle et Apis car leurs gènes TpnI manquent d'un exon 3 avec ces propriétés. (B) L'extension TpnH est codée par un seul Tm1 exon de gène dans Anophèle, alors que dans le Apis Le gène TpnI implique jusqu'à trois exons du gène 3' (séparés dans les trois rangées de l'alignement), tous codant pour une séquence riche en alanine/proline avec le motif APPAEGA (encadré grisé). Une séquence équivalente a été trouvée dans le Léthocère gène TpnI (AJ621044) et est inclus comme séquence finale dans l'alignement.

Alignement des extensions troponine I et tropomyosine alanine/proline spécifiques à l'IFM. (UNE) Bien que les séquences de l'exon 3 TpnI ne soient pas parfaitement conservées même chez les Drosophilidae, l'heptade PAANGKA (boîte ombrée) est conservée. Il se répète chez certaines espèces entourées d'une région riche en alanine/proline. Cette séquence est absente dans Anophèle et Apis car leurs gènes TpnI manquent d'un exon 3 avec ces propriétés. (B) L'extension TpnH est codée par un seul Tm1 exon de gène dans Anophèle, tandis que dans le Apis Le gène TpnI implique jusqu'à trois exons du gène 3' (séparés dans les trois rangées de l'alignement), tous codant pour une séquence riche en alanine/proline avec le motif APPAEGA (encadré grisé). Une séquence équivalente a été trouvée dans le Léthocère gène TpnI (AJ621044) et est inclus comme séquence finale dans l'alignement.

Trois nouveaux exons ont été localisés en aval de l'exon 10 dans le Apis gène TpnI. Ces exons peuvent être épissés ensemble pour produire un Apis-isoforme TpnI spécifique contenant une extension C t codant pour une séquence APPAEGA répétitive, via un nouveau site donneur d'épissage GT dans l'exon 10, situé 25 pb avant le codon stop. Cette extension est clairement similaire à l'extension riche en alanine/proline de la tropomyosine spécifique à l'IFM de grand poids moléculaire chez les diptères, à la fois en séquence et en longueur de protéine ( fig. 4B). Fait intéressant, le Apis Le gène de la tropomyosine Tm1 est dépourvu de ce type de séquence (Mateos et al., résultats non publiés). Une extension alanine/proline répétitive similaire est trouvée à l'extrémité 3' d'un transcrit du gène TpnI de l'hémiptère Léthocère (Qiu et al. 2003 et séquence AJ621044).

Le modèle d'expression des gènes TpnI et TpnT est conservé chez les drosophiles

Les profils d'expression des isoformes TpnI et TpnT dans D. subobscura et D. virilis ont été détectés par des techniques de RT-PCR (données non publiées). Toutes les transcriptions précédemment identifiées dans D. melanogaster (Barbas et al. 1993 Benoist et al. 1998) ont été détectés dans les stades larvaires du deuxième stade et les pupes tardives de ces drosophiles. Des combinaisons des exons alternatifs 3, 4 et 5 de la troponine T sont apparues dans les larves ou dans les transcrits des muscles abdominaux adultes selon des schémas caractéristiques de chaque muscle. Les transcrits majeurs des muscles thoraciques adultes ne contiennent aucun de ces exons alternatifs. L'inclusion de l'exon 9 de la troponine I se trouve exclusivement dans les transcrits de la musculature adulte, étant accompagnée de l'exon 3 dans le transcrit thoracique majeur. Les quatre types d'exon 6 ont été détectés à des niveaux variables dans tous les tissus étudiés, ceux contenant l'exon 6b1 étant les plus fortement exprimés dans l'IFM (Barbas et al. 1993).

La découverte du nouvel exon 10A de TpnT a conduit à une étude de son modèle d'expression. Une seule sonde pour l'exon constitutif 6 et quatre sondes spécifiques pour les exons 10A ou 10B ( fig. 5UNE) ont été utilisés pour la RT-PCR. Dans les embryons, seul le transcrit contenant l'exon 10B a été détecté, tandis que dans les ARN adultes entiers, des transcrits contenant soit 10A soit 10B apparaissent.

Différences dans le profil d'expression des transcrits TpnT et TpnI dans le Drosophila melanogaster musculature. Séparations sur gel d'agarose 1,2% de RT-PCR. Chaque transcrit détecté par PCR sous la forme d'une bande est marqué d'une flèche étiquetée avec le nom du gène amplifié et sa composition d'exons. (UNE) Modèle d'expression d'exons 10 mutuellement exclusifs détectés dans des extractions d'ARN adultes ou embryonnaires avec quatre amorces spécifiques à l'exon 10A ou 10B (10A1, 10A2, 10B1, et 10B2). (B) Modèles d'expression dans les parties du corps adultes (tête, IFM, TDT et abdomen). Utilisation des sondes pour TpnT exon 6 et 10A (10A2 sonde) ou 10B (10B1 sonde), le modèle d'expression de l'exon 10 est montré. L'exon 10B est exprimé dans tous les muscles de l'adulte sauf dans l'IFM. L'exon 10A est le seul exprimé dans l'IFM, mais il est également exprimé dans les muscles TDT. (C) Des sondes pour la région 3' du gène TpnI ont été utilisées en RT-PCR (exons 8-9 et 8-10). L'exon 9 utilise les deux premiers résidus de l'exon 10 pour générer un codon d'arrêt, de sorte que la sonde de l'exon 10 le détecte comme une bande inférieure, les transcrits manquant de l'exon 9, et comme une bande supérieure, les transcrits contenant l'exon 9. Donc l'exon 9 est exprimé principalement dans l'IFM et seulement faiblement dans les muscles TDT. () En utilisant les sondes de l'exon 2 et de l'exon 9 pour TpnI, on peut voir que l'exon 3 n'apparaît que fortement exprimé dans les muscles thoraciques, y compris toujours l'exon 9. Les voies de contrôle RT-négatives ne sont pas représentées.

Différences dans le profil d'expression des transcrits TpnT et TpnI dans le Drosophila melanogaster musculature. Séparations sur gel d'agarose 1,2% de RT-PCR. Chaque transcrit détecté par PCR sous forme de bande est marqué d'une flèche marquée du nom du gène amplifié et de sa composition en exons. (UNE) Modèle d'expression d'exons 10 mutuellement exclusifs détectés dans des extractions d'ARN adultes ou embryonnaires avec quatre amorces spécifiques à l'exon 10A ou 10B (10A1, 10A2, 10B1, et 10B2). (B) Modèles d'expression dans les parties du corps adultes (tête, IFM, TDT et abdomen). Utilisation des sondes pour TpnT exon 6 et 10A (10A2 sonde) ou 10B (10B1 sonde), le modèle d'expression de l'exon 10 est montré. L'exon 10B est exprimé dans tous les muscles de l'adulte sauf dans l'IFM. L'exon 10A est le seul exprimé dans l'IFM, mais il est également exprimé dans les muscles TDT. (C) Des sondes pour la région 3' du gène TpnI ont été utilisées en RT-PCR (exons 8-9 et 8-10). L'exon 9 utilise les deux premiers résidus de l'exon 10 pour générer un codon d'arrêt, de sorte que la sonde de l'exon 10 le détecte comme une bande inférieure, les transcrits manquant de l'exon 9, et comme une bande supérieure, les transcrits contenant l'exon 9. Donc l'exon 9 est exprimé principalement dans l'IFM et seulement faiblement dans les muscles TDT. () En utilisant les sondes de l'exon 2 et de l'exon 9 pour TpnI, on peut voir que l'exon 3 n'apparaît que fortement exprimé dans les muscles thoraciques, y compris toujours l'exon 9. Les voies de contrôle RT-négatives ne sont pas représentées.

La détection de l'exon 10A était particulièrement forte dans le thorax, suggérant un rôle spécifique de la séquence codée par cet exon dans la musculature liée au vol (données non présentées). Des sondes spécifiques aux exons 10A et 10B ont détecté, par RT-PCR, l'exon 10B classique dans la tête, l'abdomen et les fibres TDT disséquées ( fig. 5B). L'expression de l'exon 10A a été trouvée presque exclusivement dans le produit de RT-PCR à partir d'ARN extrait des fibres IFM et TDT bien qu'une certaine expression résiduelle ait également été détectée dans les abdomens. Par conséquent, IFM TpnT contient des séquences codées uniquement par l'exon 10A, tandis que les muscles TDT contiennent un mélange de transcrits avec l'exon 10A ou 10B. Le même enrichissement thoracique des transcrits de l'exon 10A a été obtenu en D. subobscura et D. virilis.

Les exons épissés alternativement de TpnI ont été détectés en utilisant plusieurs combinaisons de sondes. L'exon 9 est présent dans les transcrits TDT et IFM ( fig. 5C), mais alors que dans les IFM, il est le seul exprimé, dans le TDT, il est presque complètement remplacé par les transcrits contenant l'exon 10. L'utilisation de sondes pour la région codante complète (exon 2 à exon 9/10) dans les parties du corps adultes a montré que l'exon 3 épissé alternativement est exprimé dans TDT/IFM, mais n'est présent que dans les transcrits qui incorporent également l'exon 9 ( fig. 5).

Profil d'expression des gènes TpnT et TpnI dans A. mellifera

La même procédure a été effectuée avec l'abeille pour découvrir si les mêmes modèles d'abondance d'isoformes se produisent. Le profil d'expression des transcrits TpnT au cours A. mellifera développement (fig. 6UNE) montre que les muscles larvaires contiennent un mélange de transcrits avec des exons alternatifs 3, 4 et 5' ou des exons 3 et 4. Les IFM contiennent une isoforme codée par un transcrit dépourvu de tous les exons épissés alternativement de la région 5'. D'autres muscles adultes contiennent un mélange de transcrits contenant les exons 3, 4, 5 et 5′ ou 3, 4 et 5. En ce qui concerne la moitié 3′ des gènes, des transcrits contenant l'exon 10B ont été trouvés dans tous les muscles sauf en IFM, où il n'est que marginalement détecté (muscle de vol indirect dorso-ventral) ou pas du tout (muscle de vol indirect dorsolatéral). Les transcrits contenant l'exon 10A sont spécifiques du thorax adulte, similaires aux résultats des drosophiles (voir ci-dessus).

Profil d'expression des transcrits TpnI et TpnT dans Apis mellifera. Chaque transcrit détecté par PCR sous forme de bande est marqué d'une flèche marquée du nom du gène amplifié et de sa composition en exons. Les pistes vides adjacentes à chaque piste PCR sont des contrôles négatifs (ARNm sans transcription inverse). (UNE) Profil d'expression de la troponine T au cours du développement (stades larvaires L1 et L2 et pupal P1 et P2) et dans les muscles du thorax (muscles dorsoventraux du vol indirect [DV-IFM], muscles dorsolatéral du vol indirect [DL-IFM], jambes et autres muscles thoraciques musculaire) de Apis. Apis TpnT montre un modèle d'expression similaire à celui décrit dans Drosophile. (B) Le modèle d'expression TpnI dans le même échantillon est affiché. Les exons alternatifs, 9 et 10, contenant tous deux un codon stop approprié et des signaux de terminaison, sont exprimés à différents niveaux dans tous les muscles et stades. En utilisant les sondes de l'exon 4 et de l'exon H1 du Apis gène TpnI, nous avons détecté un modèle d'expression spécifique à l'IFM pour cette isoforme TpnH chez les hyménoptères. Les quatre exons 6 identifiés sont exprimés dans les transcrits TpnI (détectés par PCR interne à l'aide de sondes internes spécifiques au type de l'exon 6 dans une seconde PCR utilisant la bande de fraction P2 comme ADN substrat), sauf dans le transcrit spécifique à l'IFM où seuls les exons 6b sont détectée. (C) Les expériences d'extension d'ADNc d'amplification rapide en 3' (RACE) ont été réalisées avec des échantillons de thorax, d'IFM et de larves pour détecter les arrêts de transcription dans le Apis gène TpnI. Les transcriptions représentant huit sites d'arrêt différents ont été représentées proportionnellement sur la gauche, avec leur taille indiquée et différents styles de flèches (selon les transcriptions du dernier exon, ligne pointillée pour l'exon 9, ligne continue pour l'exon 10 et ligne brisée pour l'exon H) la bande correspondante dans les gels d'électrophorèse RACE. Trois d'entre eux (un transcrit pour chaque groupe) sont les principaux utilisés dans les muscles thoraciques (leurs longueurs sont indiquées dans des cercles), mais le transcrit contenant les exons TpnH est absent dans les muscles larvaires. Les voies de contrôle RACE-négatives sont affichées (− voies).

Profil d'expression des transcrits TpnI et TpnT dans Apis mellifera. Chaque transcrit détecté par PCR sous la forme d'une bande est marqué d'une flèche étiquetée avec le nom du gène amplifié et sa composition d'exons. Les pistes vides adjacentes à chaque piste PCR sont des contrôles négatifs (ARNm sans transcription inverse). (UNE) Profil d'expression de la troponine T au cours du développement (stades larvaires L1 et L2 et pupal P1 et P2) et dans les muscles du thorax (muscles dorsoventraux du vol indirect [DV-IFM], muscles dorsolatéral du vol indirect [DL-IFM], jambes et autres muscles thoraciques musculaire) de Apis. Apis TpnT montre un modèle d'expression similaire à celui décrit dans Drosophile. (B) Le modèle d'expression TpnI dans le même échantillon est affiché. Les exons alternatifs, 9 et 10, contenant tous deux un codon stop approprié et des signaux de terminaison, sont exprimés à différents niveaux dans tous les muscles et stades. En utilisant les sondes de l'exon 4 et de l'exon H1 du Apis gène TpnI, nous avons détecté un modèle d'expression spécifique à l'IFM pour cette isoforme TpnH chez les hyménoptères. Les quatre exons 6 identifiés sont exprimés dans les transcrits TpnI (détectés par PCR interne à l'aide de sondes internes spécifiques au type de l'exon 6 dans une seconde PCR utilisant la bande de fraction P2 comme ADN substrat), sauf dans le transcrit spécifique à l'IFM où seuls les exons 6b sont détectée. (C) Les expériences d'extension d'ADNc d'amplification rapide en 3' (RACE) ont été réalisées avec des échantillons de thorax, d'IFM et de larves pour détecter les arrêts de transcription dans le Apis gène TpnI. Les transcriptions représentant huit sites d'arrêt différents ont été représentées proportionnellement sur la gauche, avec leur taille indiquée et différents styles de flèches (selon les transcriptions du dernier exon, ligne pointillée pour l'exon 9, ligne continue pour l'exon 10 et ligne brisée pour l'exon H) la bande correspondante dans les gels d'électrophorèse RACE. Trois d'entre eux (un transcrit pour chaque groupe) sont les principaux utilisés dans les muscles thoraciques (leurs longueurs sont indiquées dans des cercles), mais le transcrit contenant les exons TpnH est absent dans les muscles larvaires. Les voies de contrôle RACE-négatives sont affichées (− voies).

Le modèle d'expression TpnI détecté à l'aide de la RT-PCR est illustré à la figure 6B. Des sondes pour la région entre les exons 4 et 9 ou les exons 4 et 10 ont révélé que des transcrits contenant l'exon 9 ou l'exon 10 sont détectés dans les différents stades de développement et dans tous les muscles de l'adulte Apis musculature. Malgré les limitations inhérentes à ces expériences de PCR, les transcrits contenant l'exon 9 semblent apparaître plus tard que ceux contenant l'exon 10. En utilisant des sondes pour chaque exon 6 et exon 8 spécifiques dans une PCR interne des produits amplifiés précédents, les quatre exons 6 dans les deux exons Des transcrits contenant 9 et l'exon 10 ont été détectés. Bien que la PCR quantitative n'ait pas été réalisée, les résultats indiquent que les niveaux d'expression maximum des exons 6a et 10 se produisent pendant les stades larvaires, tandis que ceux des exons 6b et 9 se produisent chez les adultes.

Enfin, la RT-PCR utilisant des sondes conçues pour amplifier la région entre l'exon 4 et l'exon H1 du Apis Le gène TpnI a montré, comme prévu, qu'une forte Apis La TpnI (troponine H) est exprimée exclusivement dans l'IFM ( fig. 6B). Cette bande a été clonée et testée pour son contenu en exon 6, en utilisant une sonde de l'exon 8 en combinaison avec une sonde spécifique pour chacun des quatre exons 6. Le séquençage de 14 clones a confirmé que 7 clones contenaient l'exon 6b1 et les 7 autres clones contenaient l'exon 6b2. De plus, ces transcrits TpnH incluent une version épissée plus courte de l'exon 10 qui n'a pas pu être détectée dans les tests RT-PCR antérieurs utilisant la sonde de l'exon 10. Afin de localiser les extrémités 3' des transcrits TpnI, nous avons effectué des expériences d'extension d'ADNc d'amplification rapide avec trois représentants Apis Fractions d'ARN ( fig. 6C). Nous avons trouvé jusqu'à huit extrémités de transcription différentes pour le gène TpnI, mais seules trois principales se produisent dans l'ARNm des muscles thoraciques et des échantillons d'IFM. Deux d'entre eux sont 3' à l'exon 9 et à l'exon 10, produisent les transcrits TpnI standard et sont également utilisés dans les muscles larvaires. L'autre extrémité incorpore la partie initiale de l'exon 10 mais s'étend dans les exons H1, H2 et H3, produisant un TpnH isoforme avec une longue extension riche en alanine/proline. Nous avons également détecté un transcrit dans lequel l'exon H1 n'utilise pas son site d'épissage accepteur et cela produirait un TnH isoforme avec une extension plus courte riche en alanine/proline.


Base génétique, diagnostic et gestion

Fond: Le syndrome d'hypoventilation centrale congénitale (CCHS) est caractérisé par une hypoventilation alvéolaire et un dérèglement autonome.

But: (1) Démontrer l'importance de PHOX2B tests dans le diagnostic et le traitement des patients atteints de CCHS, (2) pour résumer les avancées récentes dans la compréhension de la façon dont les mutations PHOX2B gène conduire au phénotype CCHS, et (3) pour fournir une mise à jour sur les recommandations pour le diagnostic et le traitement des patients atteints de CCHS.

Méthodes: Les membres du comité ont été invités sur la base de leur expertise dans l'ESCC et invités à passer en revue l'état actuel de la science en effectuant indépendamment des recherches documentaires. Un consensus sur les recommandations a été atteint par accord entre les membres du Comité.

Résultats: Une revue de la littérature pertinente a permis l'élaboration d'un document qui résume les progrès récents dans la compréhension de l'ESCC et l'interprétation des experts des données probantes pour la prise en charge des patients atteints.

Conclusion: UNE PHOX2B mutation est nécessaire pour confirmer le diagnostic de CCHS. Connaissance des spécificités PHOX2B La mutation aide à anticiper la gravité du phénotype de l'ESCC. Les parents de patients atteints de CCHS devraient subir un test de dépistage PHOX2B mutations. Le maintien d'un indice de suspicion élevé dans les cas d'hypoventilation alvéolaire inexpliquée permettra probablement d'identifier une incidence plus élevée de cas plus légers de CCHS. Les options de gestion recommandées visant à maximiser la sécurité et à optimiser les résultats neurocognitifs comprennent : (1) évaluation complète à l'hôpital semestrielle puis annuelle avec (je(ii) Surveillance Holter 72 heures, (iii) échocardiographie, (iv) évaluation de la dérégulation du SNA dans tous les systèmes organiques touchés par le SNA, et (v) évaluation neurocognitive formelle (2) lavement baryté ou manométrie et/ou biopsie rectale pleine épaisseur pour les patients ayant des antécédents de constipation et (3) l'imagerie pour les tumeurs de la crête neurale chez les individus les plus à risque sur la base de PHOX2B mutation.

PHOX2B: Le gène déterminant la maladie pour l'ESCC

PHOX2B Mutations dans l'ESCC

PHOX2B Génotype/Phénotype de l'ESCC

Mosaïcisme dans un sous-ensemble de parents ayant des enfants de l'ESCC

Héritage de l'ESCC et de la PHOX2B Mutation

Mécanisme par lequel les mutations dans PHOX2B Résultat du gène dans le phénotype de l'ESCC

Un modèle pour la médecine autonome transitionnelle et translationnelle

En 1999, l'American Thoracic Society a publié la première déclaration sur le syndrome d'hypoventilation centrale congénitale (CCHS) (1). Depuis, le monde de l'ESCC a explosé avec (1) la découverte que l'homéobox 2B de type appairé (PHOX2B) est le gène définissant la maladie pour l'ESCC (2–5) (2) identification d'un mode de transmission autosomique dominant (3, 5-7) (3) démonstration d'un PHOX2B relation génotype-phénotype CCHS pertinente pour la dépendance ventilatoire (3, 5), la dysmorphologie faciale (8), les asystoles cardiaques (9) et la maladie de Hirschsprung et le neuroblastome (6, 7) (4) identification de PHOX2B mutations chez les adultes de l'ESCC et les enfants plus âgés (10-17) dont le diagnostic a été « manqué » ou n'était pas apparent au cours de la période néonatale, de la petite enfance et de la petite enfance (5) documentation du mosaïcisme chez 5 à 10 % des parents d'enfants atteints d'ESCC (3, 6) et (6) une meilleure compréhension des mécanismes spécifiques par lesquels PHOX2B résultats dans le phénotype CCHS (6, 18-21). Le but d'un nouvel énoncé ATS sur l'ESCC est d'aider le clinicien à optimiser les soins aux patients qui seront spécifiquement adaptés à la connaissance de l'individu PHOX2B génotype/mutation, et proposer un conseil génétique. Enfin, toutes les options de gestion seront abordées avec les objectifs à long terme d'amélioration de la qualité de vie des PHOX2B des individus porteurs d'une mutation confirmée par l'ESCC et d'acquérir une meilleure compréhension du système nerveux autonome (SNA) dans le cadre de la santé et de la maladie. Ceux-ci inclus (1) bilan hospitalier semestriel puis annuel avec (je(ii) Surveillance Holter 72 heures, (iii) échocardiographie, (iv) évaluation de la dérégulation du SNA dans tous les systèmes organiques touchés par le SNA, et (v) évaluation neurocognitive formelle (2) lavement baryté ou manométrie et/ou biopsie rectale pleine épaisseur pour les patients ayant des antécédents de constipation et (3) l'imagerie pour les tumeurs de la crête neurale chez les individus les plus à risque sur la base de PHOX2B mutation.

Les membres du comité ont été invités en raison de leur expertise dans la prise en charge des patients atteints de CCHS en termes de soins cliniques, de recherche clinique ou d'investigation scientifique fondamentale. Des représentants des communautés pédiatriques et adultes ont été inclus. L'intention était la représentation internationale. Les membres du comité ont été invités à examiner l'état actuel de la science en effectuant indépendamment des recherches documentaires à l'aide de Pub Med et OVID. Chaque membre du comité a été invité à évaluer la littérature identifiée, à fournir une critique des articles et à évaluer l'importance des articles individuels. Les articles les mieux classés et les critiques ont été intégrés dans le document de travail. Un consensus sur les recommandations a été atteint parmi les membres du Comité.

Informer le praticien, le parent, l'aidant et le fournisseur de soins de santé qu'un PHOX2B mutation est nécessaire à la confirmation d'un diagnostic de CCHS.

Pour améliorer les connaissances générales concernant PHOX2B comme gène définissant la maladie pour le CCHS. Le lecteur apprendra que (je) environ 90 % des individus présentant le phénotype CCHS sont hétérozygotes pour une mutation répétée d'expansion de polyalanine dans le PHOX2B gène, (ii) environ 10 % des personnes atteintes de CCHS sont hétérozygotes pour une mutation faux-sens, non-sens ou de décalage du cadre de lecture dans le PHOX2B gène, (iii) d'autres diagnostics non liés à l'ESCC doivent être recherchés si un PHOX2B la mutation n'est pas trouvée.

Introduire la possibilité d'anticiper le phénotype de l'ESCC en fonction de la PHOX2B génotype/mutation.

Informer les cliniciens que l'ESCC n'est plus diagnostiquée exclusivement au cours de la période néonatale, comme elle est maintenant décrite chez les tout-petits, les enfants et les adultes.

Pour se concentrer sur le mode de transmission autosomique dominant de la PHOX2B mutation dans l'ESCC, la découverte de mosaïcisme chez 5 à 10 % des parents, et l'importance de tester les deux parents de chaque sujet avec l'ESCC.

Mieux comprendre les mécanismes spécifiques par lesquels PHOX2B donne le phénotype de l'ESCC.

Mettre à jour les informations concernant les traitements disponibles et les options de soins de santé à domicile.

Reconnaître que l'ESCC est un modèle pour la médecine autonome translationnelle et transitionnelle. En plus d'utiliser le PHOX2B mutation génétique pour optimiser la prise en charge des patients, les cliniciens devront continuer à prendre en charge ces patients particuliers au fur et à mesure qu'ils atteignent l'âge adulte.

L'ESCC a été décrite pour la première fois en 1970 par Robert Mellins et ses collègues (22). Malgré une multitude de rapports de cas, de grandes séries n'ont été publiées qu'en 1992 (23). La déclaration de l'ATS de 1999 sur l'ESCC estimait « environ 160 à 180 enfants vivants atteints d'ESCC dans le monde », mais précisait que ces chiffres « sont considérés comme une sous-estimation » (1). En 2009, les laboratoires collectifs des États-Unis, de France, d'Italie, du Japon, d'Allemagne, de Taïwan, de Chine, des Pays-Bas, du Chili, du Royaume-Uni et d'Australie ont désormais diagnostiqué près de 1 000 cas de PHOX2B ESCC confirmée par mutation. Même maintenant, cela est reconnu comme une sous-estimation, car les individus avec le phénotype le plus doux sont sous-diagnostiqués. Bien que l'ESCC soit typiquement diagnostiquée au cours de la période néonatale, des rapports récents indiquent que les individus peuvent être diagnostiqués pendant l'enfance (5, 6, 17, 24-26) et l'âge adulte (10-17, 26), selon le PHOX2B génotype et la curiosité intellectuelle du patient, de la famille et de l'équipe médicale. Quel que soit l'âge au moment de la présentation, les personnes atteintes de CCHS seront diagnostiquées cliniquement en l'absence de maladie pulmonaire, cardiaque ou neuromusculaire primaire ou d'une lésion identifiable du tronc cérébral qui pourrait expliquer la tout phénotype incluant le dérèglement du système nerveux autonome (ANSD). Les personnes atteintes de CCHS ont typiquement des volumes courants réduits et des fréquences respiratoires monotones éveillées et endormies (1), bien que l'hypoventilation alvéolaire plus profonde se produise principalement pendant le sommeil. En raison de l'hypoventilation, ces individus deviendront hypoxémiques et hypercarbiques, mais manqueront généralement de réactivité à ces défis endogènes en termes de ventilation et d'éveil pendant le sommeil, et ils n'auront pas la perception de l'asphyxie pendant l'éveil avec et sans effort (1). Les affections associées à la CCHS reflétant l'ANSD anatomique comprennent la maladie de Hirschsprung (HSCR) et les tumeurs d'origine de la crête neurale en plus d'un spectre de symptômes compatibles avec l'ANSD physiologique, notamment une diminution de la réponse pupillaire à la lumière, une dysmotilité œsophagienne, des périodes d'apnée, une diminution de la température corporelle basale, transpiration abondante sporadique, manque de perception de la dyspnée, perception altérée de l'anxiété et manque de réactivité physiologique aux défis de l'exercice et des facteurs de stress environnementaux (1, 23, 27-39). L'ESCC est une maladie qui dure toute la vie, ce qui soulève des questions clés, notamment : (1) le phénotype changera-t-il avec l'âge en fonction de la PHOX2B mutation, âge au diagnostic et adéquation de la prise en charge ? et (2) les stratégies d'intervention seront-elles efficaces compte tenu de la nature de la mutation et de son timing en termes de développement embryologique ? Étant donné que le but de cette déclaration n'est pas de fournir un examen exhaustif de l'ESCC, le lecteur est invité à consulter les revues récentes (www.genereviews.org et références 40 et 41).

Des indices sur le caractère familial de l'ESCC sont apparus entre les années 1980 et 2001. Les données sur la récurrence familiale comprennent un rapport sur chacune des jumelles monozygotes (42), des sœurs (43), des frères et sœurs hommes-femmes (23, 44) et des demi-frères et sœurs hommes-femmes. (45) avec l'ESCC. Dans le pré-PHOX2BÀ l'époque de l'ESCC, cinq femmes ayant reçu un diagnostic d'ESCC dans leur propre enfance ont donné naissance à deux nourrissons atteints d'un ESCC certain, un avec un ESCC probablement confondu par une immaturité grave et une dysplasie bronchopulmonaire, et un avec un ESCC d'apparition plus tardive (46, 47). Un rapport d'un enfant atteint de CCHS né d'une femme qui avait eu un neuroblastome dans son enfance (48) a ajouté à la prémisse d'une composante génétique transmise dans le spectre phénotypique de l'ANSD et de la CCHS. De plus, l'ANSD a été étudiée dans une conception familiale cas-témoins (27, 28), qui a fourni d'importantes preuves de confirmation d'une base génétique à l'ESCC et est donc considérée comme la manifestation la plus grave d'une ANS général (1, 27, 44), bien que le rôle de PHOX2B dans la catégorie plus large des ANS reste inconnue.

La plupart des premières études, entreprises à la recherche de la base génétique de la CCHS, se limitaient aux gènes connus pour être liés à la HSCR. Vingt patients présentaient des mutations modifiant les protéines dans le récepteur tyrosine kinase (RET) (49-53), facteur neurotrophique dérivé des cellules gliales (GDNF) (49), voie de signalisation de l'endothéline 3 (EDN3) (52, 54), facteur neurotrophique dérivé du cerveau (BDNF) (55), gène homologue aschaete-scute humain (HASH1) (4, 56), gène de type homéoboîte apparié 2A (PHOX2A) (4), GFRA1 (4), protéine morphogénique osseuse 2 (BMP2) (3), et l'enzyme de conversion de l'endothéline 1 (ECE1) (3). Trois autres rapports indiquent une absence de RET (57) et RNX mutations (58, 59).

En 2003, PHOX2B s'est avéré être le gène déterminant la maladie de l'ESCC (2, 3). PHOX2B code pour un facteur de transcription homéodomaine hautement conservé connu pour jouer un rôle clé dans le développement des circuits réflexes du SNA chez la souris (60, 61). PHOX2B contient une séquence répétée de 20 alanines dans l'exon 3, qu'Amiel et ses collègues ont signalé comme contenant des duplications dans le cadre de 15 à 27 nucléotides, conduisant à l'expansion du tractus répété à 25 à 29 alanines sur l'allèle affecté dans 18 des 29 (62 %) Cas d'ESCC français (2). Ces extensions semblaient être de novo dans la mesure où ils n'étaient pas présents dans huit ensembles de parents des cas de l'ESCC. Deux des 29 (7 %) cas d'ESCC présentaient des mutations de décalage du cadre de lecture. Collectivement, 69 % des 29 patients français étaient hétérozygotes pour un PHOX2B mutation, mais aucun des témoins n'avait PHOX2B mutations. Amiel et ses collègues (2) ont également démontré PHOX2B expression dans les premiers embryons humains dans les circuits neuronaux autonomes centraux et dans les dérivés de la crête neurale périphérique.

Parallèlement aux études françaises, Weese-Mayer et ses collègues (3) se sont concentrés sur les gènes impliqués dans l'embryologie précoce du SNA (mammalian aschaete-scute homologue-1 [MASH1], BMP2, engrail-1 [FR1], TLX3, ECE1, endothéline-1 [EDN1], et PHOX2A). Bien qu'aucune nouvelle mutation causant la maladie n'ait été trouvée dans aucun de ces gènes dans une cohorte de 67 cas d'ESCC, Weese-Mayer et ses collègues (3) ont identifié des hétérozygotes PHOX2B expansions répétées de la polyalanine de l'exon 3 de 25 à 33 répétitions chez 65 des 67 (97 %) enfants présentant le phénotype CCHS. Sur les deux autres cas d'ESCC, une mutation non-sens (codon stop prématuré) dans PHOX2B a été identifié chez un patient et l'autre s'est avéré plus tard avoir une expansion répétée de polyalanine dans PHOX2B après qu'une confusion d'échantillons au laboratoire d'origine ait été résolue (7). Collectivement, Weese-Mayer et ses collègues (3) ont identifié des mutations dans l'exon 3 du PHOX2B gène chez 100 % des 67 enfants présentant le phénotype CCHS, ce qui indique que PHOX2B est le gène déterminant la maladie dans l'ESCC. Aucun des PHOX2B des mutations d'expansion étaient présentes chez 67 témoins appariés selon le sexe/l'origine ethnique. Cette étude a également noté (1) une association entre la longueur d'expansion de la polyalanine et la sévérité du dysfonctionnement autonome (2) mosaïcisme chez 4 des 97 parents de cas de l'ESCC, ce qui suggère que tous PHOX2B des mutations se produisent de novo (3) transmission autosomique dominante de la PHOX2B mutation et le phénotype CCHS des cas CCHS et (4) transmission autosomique dominante de la PHOX2B mutation de parents mosaïques. En outre, ces auteurs (3) ont établi le premier test cliniquement disponible pour le diagnostic du CCHS en utilisant une méthode simple et précise pour détecter et dimensionner la séquence répétée associée à l'expansion du tractus polyalanine (brevet Rush University Medical Center, Chicago, IL brevet donné à fiducie de bienfaisance et le produit de PHOX2B Les tests de dépistage soutiennent la recherche de l'ESCC), qui pourraient également être utilisés pour le diagnostic prénatal, les tests familiaux et le diagnostic des personnes présentant des symptômes pertinents.

Suite aux études ci-dessus, PHOX2B des expansions répétées de polyalanine ont été trouvées dans 4 (40 %) et un PHOX2B mutation de décalage du cadre d'insertion dans 1 (10 %) des 10 cas d'ESCC au Japon (4). L'expansion s'est avérée de novo dans 2 cas. Sasaki et ses collègues (4) ont utilisé la même méthodologie que les Français (2) et ont également sous-détecté PHOX2B cas d'expansion signalés en 2005 (62). En 2004, Matera et ses collègues (5) ont identifié des hétérozygotes PHOX2B des mutations d'expansion de la polyalanine de 25 à 33 répétitions dans 21 (88 %) et des mutations hétérozygotes de décalage du cadre de lecture dans 2 (8 %) des 24 cas d'ESCC en Italie, en Allemagne et aux Pays-Bas. Cette étude a confirmé la corrélation entre la taille des PHOX2B allèle élargi et la sévérité du phénotype respiratoire et des symptômes associés (3). Matera et ses collègues ont également démontré que dans les réactions en chaîne par polymérase standard, l'allèle élargi associé au CCHS, en particulier ceux avec 30 à 33 alanines, peut rester non détecté en raison de la région polyalanine riche en GC de PHOX2B Ainsi, le PHOX2B le taux de mutation peut être sous-estimé en raison de l'abandon d'allèles induit par l'amplification. À l'aide de tests conçus pour amplifier les régions riches en GC, Trang et ses collègues (63) ont (ré)analysé 34 des patients français et identifié un PHOX2B mutation dans 91% des cas, et Trochet et ses collègues (6) ont trouvé PHOX2B mutations chez 93 % des 174 sujets atteints de CCHS de plusieurs nationalités, dont 7 des 9 patients « mutation-négatifs » rapportés par Amiel et ses collègues en 2003 (2). Berry-Kravis et ses collègues (7) et Weese-Mayer et ses collègues (64) ont rapporté PHOX2B mutations chez 184 sujets (en 2006) et collectivement plus de 350 sujets (en 2008) avec CCHS, respectivement (100 % de sensibilité et spécificité de détection), dans une cohorte majoritairement américaine, avec 10 % de patients étrangers.

Comme résumé précédemment (40, 41) (www.genereviews.org), la plage pour le nombre de répétitions dans le PHOX2B l'expansion de la polyalanine sur l'allèle affecté chez les patients atteints de CCHS est de 24 à 33 (2-7, 13, 15-17, 25, 26, 65-70). Les mutations d'expansion répétées de polyalanine (PARM) n'ont pas été trouvées chez 482 témoins des publications citées ci-dessus ni chez 1520 individus sains à Taïwan (67). Des variantes de contraction dans le cadre (avec 7, 13, 14 ou 15 répétitions dans le tractus répété polyalanine) ont été signalées dans trois cas d'ESCC (3, 7, 71) qui hébergent une mutation répétée d'expansion polyalanine supplémentaire ou une mutation répétée non polyalanine (NPARM ), mais sont également retrouvés chez environ 3 % des témoins apparemment normaux (2, 3, 5, 72, 73), les parents de l'ESCC (3, 16, 71) et un petit sous-ensemble de patients présentant des symptômes vagues suggérant un dérèglement autonome et/ ou hypoventilation sporadique, ou événements potentiellement mortels apparents, mais pas la constellation de symptômes caractéristiques de l'ESCC (71). UNE PHOX2B une mutation d'expansion répétée de polyalanine ségrégeant avec la maladie a été observée chez 9 des 16 patients atteints de RET, GDNF, BDNF, HASH1, et GFRA1 mutations fortuites, indiquant ainsi que PHOX2B est le gène déterminant la maladie chez ces enfants.

Une mutation dans le PHOX2B gène est nécessaire au diagnostic de CCHS. Plus de 90 % des cas d'ESCC seront hétérozygotes pour un PARM dans le cadre codant pour 24 à 33 alanines dans la protéine mutée et produisant des génotypes de 20/24 à 20/33 (le génotype normal serait appelé 20/20). Les 10 % environ restants des patients présentant un phénotype CCHS classique seront hétérozygotes pour un NPARM (74) (y compris faux-sens, non-sens et décalage du cadre de lecture) dans le PHOX2B gène. Les génotypes 20/25, 20/26 et 20/27 sont les plus courants, bien qu'un nombre croissant de mutations, même les moins courantes, soit identifié chaque mois (voir un histogramme de toutes les données publiées ainsi que toutes les données actuelles des auteurs à la fin de 2009 dans la figure 1).

Figure 1. Nombre de PHOX2B mutations répétées de polyalanine par génotype. Ces données représentent toute la littérature publiée ainsi que les données actuelles fournies par les auteurs de la déclaration pour les mutations répétées polyalanine (PARM) et les mutations répétées non polyalanine (NPARM). Les génotypes les plus courants sont 20/25, 20/26 et 20/27. Adapté avec la permission de la référence 41.

Des NPARM (74) ont été signalés en association avec l'ESCC par des groupes aux États-Unis (3, 7, 20, 41, 64), en Italie (5, 16, 18), au Japon (4), en France (2, 6, 13 , 75), Allemagne (50, 69, 76), Australie (77), Pays-Bas (78), Chine (79) et Taïwan (67, 80). Jusqu'à présent, 76 personnes atteintes d'ESCC et de NPARM dans PHOX2B ont été décrites dans le monde entier, et les mutations comprennent principalement des mutations de décalage du cadre de lecture (59/76, 78 %), mais aussi un non-sens (3/76, 4 %), un faux-sens (12/76, 16 %) et un faux-sens avec altération du codon stop (2 /76, 3%) (voir Figure 2 pour un schéma de toutes les données publiées ainsi que de toutes les données actuelles des auteurs de la déclaration). La majorité des NPARM associés à l'ESCC se trouvent à la fin de l'exon 2 ou dans l'exon 3 (figure 2).

Figure 2. Schéma pour le PHOX2B gène avec l'emplacement de toutes les mutations associées à l'ESCC décrites à ce jour dans PHOX2B. Toutes les mutations répétées de polyalanine (PARM) sont situées dans le deuxième tronçon polyalanine de l'exon 3. Presque toutes les NPARM identifiées à ce jour se trouvent à l'extrémité 3' de l'exon 2 ou dans l'exon 3. Ces données représentent toute la littérature publiée et les données actuelles fournies par les auteurs de la Déclaration (41). Reproduit avec la permission de la référence 41.

La majorité des NPARM surviennent de novo et produisent des phénotypes très sévères avec HSCR et une atteinte intestinale étendue, un besoin d'assistance ventilatoire continu et un risque accru de tumeur chez les personnes de plus d'un an (6, 7). Ainsi, la présence d'une HSCR étendue et d'un phénotype CCHS est un bon prédicteur d'une PHOX2B NPARM. Des délétions récurrentes de 38 et 35 paires de bases, provoquant un décalage du cadre de lecture de la répétition polyalanine dans toute la protéine, produisent une maladie grave et ont été identifiées par plusieurs groupes dans différents pays. Une minorité de NPARM est associée à une incidence élevée de HSCR mais à un phénotype physiologique de CCHS plus léger et à une pénétrance incomplète dans au moins 3 familles (7). Quelques mutations de décalage du cadre de lecture situées de manière similaire (618delC, 577delG) ont été héritées et sont pénétrantes de manière variable dans les familles (5, 7), suggérant que les décalages de cadre de -1 dans cette zone peuvent produire un déficit cellulaire plus léger que d'autres mutations de décalage du cadre de lecture. Les mutations c.422G > A et c.428A > G, conduisant respectivement à p.R141Q et p.Q143R, ont également été trouvées dans plusieurs cas non liés de CCHS et, avec le c.299G > T (p.R100L ) (20), sont les seules mutations faux-sens encore identifiées dans l'ESCC. Le c.419C > A (p.A140E) a récemment été signalé dans l'ESCC d'apparition tardive, à la fois isolé et associé à la HSCR (13, 81).

Malgré l'identification qui PHOX2B est le gène déterminant la maladie de l'ESCC en 2003, les revues continuent de publier des recherches sans (1) confirmation que tous les sujets avec « ESCC » ont PHOX2B mutations, (2) une distinction dans l'analyse des données entre les sujets PHOX2B l'ESCC confirmée par mutation et les enfants présentant d'autres causes d'hypoventilation, et (3) l'analyse des données dans un PHOX2B format de génotype/phénotype CCHS. En raison du rôle crucial de PHOX2B dans le développement du SNA, il est pertinent d'émettre l'hypothèse d'une relation entre PHOX2B génotype et les aspects suivants du phénotype de l'ESCC.

Il existe une relation entre le génotype des PARM et le besoin d'une dépendance ventilatoire continue (3, 5, 7, 65). Plus précisément, les individus avec le génotype 20/25 ont rarement besoin d'une assistance ventilatoire 24 heures par jour. assistance ventilatoire. Les cas d'apparition tardive avec le génotype 20/24 ou 20/25 (10, 11, 17) présentent l'hypoventilation la plus légère, se présentant principalement après une exposition à des dépresseurs respiratoires ou à une infection respiratoire sévère, et sont traités uniquement avec une assistance ventilatoire nocturne. Contrairement aux PARM, la plupart des personnes atteintes de NPARM nécessitent une assistance ventilatoire continue (7) (Figure 3).

Figure 3. Taux de dépendance ventilatoire continue, de maladie de Hirschsprung et de tumeurs de la crête neurale dans les cas de syndrome d'hypoventilation centrale congénitale (CCHS) avec mutations répétées d'expansion de polyalanine (PARM) chez PHOX2B par rapport aux cas de l'ESCC avec des mutations d'expansion répétées non polyalanine (NPARM) dans PHOX2B. Les cas de l'ESCC inclus dans cette figure ont été compilés à partir de tous les cas connus signalés dans la littérature, y compris les rapports de groupes aux États-Unis, en Italie, en France, au Japon, en Allemagne, à Taïwan, en Chine, en Australie et aux Pays-Bas ainsi que les informations actuelles rapportées par les auteurs de la déclaration, lorsque des informations cliniques adéquates étaient disponibles. Les données sur les tumeurs de la crête neurale provenaient de cas pour lesquels des informations étaient disponibles et où l'enfant avait survécu au moins la première année de vie. Tous les cas de PARM avec tumeurs présentaient de grandes mutations d'expansion (29-33 répétitions). Adapté avec la permission de la référence 41.

Reconnue depuis longtemps comme survenant parmi 20 % des cas d'ESCC, la RCS est plus clairement prévalente parmi les cas de NPARM que de PARM. Plus précisément, la HSCR est signalée dans 87 à 100 % des NPARM, contrairement à 13 à 20 % des PARM (6, 7, 65) (voir Figure 3 pour un histogramme de toutes les données publiées suffisamment détaillées ainsi que de toutes les données actuelles fournies par les auteurs de la déclaration ATS). Parmi les PARM, il n'y a aucun rapport de HSCR survenant chez les sujets avec le génotype 20/25, et seulement rarement avec le génotype 20/26. Une fréquence élevée de HSCR chez les individus avec le génotype 20/27 a été signalée dans une cohorte (6) mais n'a pas encore été définitivement confirmée dans d'autres. Des études récentes suggèrent en outre que le RET Ce gène pourrait jouer un rôle central en tant que gène modificateur du phénotype HSCR chez les patients atteints de CCHS (53, 82).

Les tumeurs d'origine de la crête neurale surviennent plus fréquemment chez les personnes atteintes de NPARM (50 %) que parmi celles atteintes de PARM (1 %) (6, 7, 65) ( Figure 3 ) (tous les neuroblastomes). Cependant, parmi les PARM, seuls les sujets avec les génotypes 20/29 et 20/33 (2, 3, 6, 7) ont été identifiés comme ayant des tumeurs d'origine de la crête neurale (ganglioneuromes et ganglioneuroblastomes) jusqu'à présent.

Un rapport récent de Gronli et ses collègues (9) a identifié une corrélation entre les PARM les plus courants (génotypes 20/25-20/27) et la longueur des intervalles R-R sur la surveillance Holter. Plus précisément, aucun des enfants avec le génotype 20/25 n'a eu de pause sinusale de 3 secondes ou plus. Cependant, 19% des individus avec le génotype 20/26 et 83% des individus avec le génotype 20/27 ont eu des pauses de 3 secondes ou plus. De même, des stimulateurs cardiaques ont été implantés chez 0 % des sujets de génotype 20/25, 25 % des sujets de génotype 20/26 et 67 % des sujets de génotype 20/27. Parmi les cas des génotypes 20/26 et 20/27 qui n'ont pas reçu de stimulateur cardiaque, deux sont décédés subitement et un présentait une grave atteinte neurocognitive. De plus, un adulte avec le génotype 20/25, diagnostiqué avec le CCHS à l'âge adulte, avait documenté des pauses de 8 secondes et plus (11) et les auteurs de la déclaration ATS ont été alertés d'un autre adulte plus tardif avec le génotype 20/25 et prolongé asystoles sur enregistrement Holter. Ces résultats soulèvent des inquiétudes quant au fait que les individus avec le génotype 20/25 peuvent ne pas être affectés pendant l'enfance mais, s'ils ne sont pas correctement gérés ou diagnostiqués rapidement, peuvent présenter des asystoles prolongées à l'âge adulte. Le risque pour les personnes atteintes de NPARM reste incertain.

Weese-Mayer et ses collègues et Patwari et ses collègues (3, 83) ont démontré qu'un nombre accru de répétitions de polyalanine était associé à un nombre accru de symptômes de dérégulation du SNA (Figure 4). Bien que ces mesures de l'ANSD aient été déterminées à partir de l'examen des dossiers médicaux, des questionnaires scénarisés et de l'évaluation physiologique, elles n'incluaient pas de tests spécifiques pour évaluer la fonction autonome. Cependant, les médecins et les parents doivent s'attendre à plus de symptômes d'ANSD chez les sujets de génotypes 20/27 à 20/33.

Figure 4. Nombre de symptômes de dérégulation du système nerveux autonome (ANSD) dans les cas de syndrome d'hypoventilation centrale congénitale (CCHS) versus PHOX2B génotype chez 65 enfants porteurs d'une mutation d'expansion répétée polyalanine (PARM). Le nombre de symptômes de l'ANSD augmente avec le nombre d'alanines dans la PARM. De nombreux sujets avaient des nombres identiques pour les symptômes et le génotype de l'ANSD, par conséquent, le chiffre donne l'illusion de moins de points de données que prévu pour la taille de la cohorte. L'analyse du génotype mesuré (consistant à comparer les moyennes génotypiques par ANOVA) a révélé une association significative entre PHOX2B longueur de la mutation répétée polyalanine et nombre de symptômes de dérégulation du SNA (F = 2,93, df = 5, P = 0,021). Adapté avec la permission de la référence 3.

Un rapport de Todd et ses collègues (8) a décrit un faciès caractéristique chez les enfants âgés de 2 ans au début de l'âge adulte atteints d'ESCC et principalement chez les personnes atteintes de PARM. Les visages des sujets atteints de CCHS étaient généralement plus courts et plus plats, et présentaient généralement une inflexion inférieure du tiers latéral du bord supérieur vermillon (trait de la lèvre). Bien qu'il ne soit pas dysmorphique, le visage est court par rapport à sa largeur, ce qui donne le visage caractéristique en forme de boîte observé dans l'ESCC. Quatre-vingt-six pour cent des cas de l'ESCC et 82 % des témoins ont été correctement prédits à l'aide de cinq variables pour caractériser le faciès (hauteur de la lèvre supérieure, largeur bioculaire, hauteur faciale supérieure, protrusion de la pointe du nez et trait de la lèvre). Un nombre limité de cas avec un nombre plus élevé de répétitions (seulement cinq cas avec 30 à 33 répétitions) peut avoir empêché l'identification d'une corrélation significative entre le nombre de répétitions de polyalanine et les mesures du phénotype facial de l'ESCC.

Todd et ses collègues (84) ont évalué la fréquence des types de motifs dermatoglyphiques, la symétrie gauche/droite et la corrélation génotype/phénotype dans l'ESCC. Les fréquences des types de motifs dermatoglyphiques étaient modifiées dans les cas de CCHS par rapport aux témoins : une augmentation des arcs chez les femmes et des anses ulnaires chez les hommes, avec les plus grandes différences pour la main gauche et pour les individus atteints à la fois de CCHS et de HSCR, a été signalée. Les scores de dissemblance entre les cas de l'ESCC et de l'ESCC/HSCR, et entre tous les cas de sexe féminin et tous les cas de sexe masculin n'étaient pas significativement différents. Aucune association significative n'a été trouvée entre le nombre de répétitions de polyalanine dans le PHOX2B catégorie génotypique et fréquences de motifs dermatoglyphiques dans les groupes d'étude de l'ESCC.

Le terme « congénital », tel qu'utilisé historiquement dans l'ESCC, connotait la présentation au cours de la période néonatale. Cependant, des patients se présentant en dehors de la période néonatale avec une apparition tardive (LO)-CCHS ont été décrits précédemment (5, 6, 10-17, 24-26, 85). Dans le contexte de (1) sensibilisation accrue à l'ESCC (2) la découverte que PHOX2B est le gène déterminant la maladie de l'ESCC et 3) la disponibilité des tests de diagnostic clinique pour PHOX2B mutations, une augmentation du diagnostic de LO-CCHS avec présentation plus tard dans la petite enfance, l'enfance et l'âge adulte est attendue.

LO-CCHS reflète la pénétrance variable du PHOX2B mutations avec les génotypes 20/24 et 20/25 ou rarement un NPARM qui peut nécessiter un cofacteur environnemental pour susciter le phénotype. Un examen attentif des antécédents médicaux des personnes « présentant » une hypoventilation alvéolaire après la période néonatale montre souvent des signes et des symptômes compatibles avec une hypoventilation antérieure et d'autres troubles de la régulation autonome de la période néonatale. Le diagnostic de LO-CCHS doit être envisagé en cas d'hypoventilation alvéolaire à médiation centrale et/ou de cyanose ou de convulsions notés après (1) administration d'anesthésiques ou de dépresseurs du SNC, (2) infection pulmonaire sévère récente, ou (3) traitement de l'apnée obstructive du sommeil. Avec une suspicion clinique accrue de LO-CCHS, le médecin peut accélérer le diagnostic en testant rapidement un PHOX2B mutation, évitant ainsi une décompensation potentiellement mortelle ainsi qu'un risque de compromis neurocognitif. L'évaluation des cas de présentation ultérieure nécessite une anamnèse minutieuse avec une attention particulière à l'exposition passée à l'anesthésie ou à la sédation, le retard de « récupération » d'une maladie respiratoire grave et les crises inexpliquées ou les troubles neurocognitifs. En outre, examen des photographies numériques frontales et latérales (pour évaluer les faciès compatibles avec l'ESCC, les hommes adultes ont souvent une moustache pour dissimuler le « trait de la lèvre »), toute documentation électrocardiographique de pauses sinusales prolongées (idéalement via une surveillance Holter de 72 h), toute des évaluations physiologiques documentant la ventilation pendant l'éveil et le sommeil (pour l'hypercapnie et/ou l'hypoxémie), un hématocrite et une numération des réticulocytes (pour la polyglobulie et la réponse à l'hypoxémie), un taux de bicarbonate (pour les signes d'acidose respiratoire compensée), ou une radiographie pulmonaire, un échocardiogramme ou un électrocardiogramme (pour les signes d'hypertrophie de la chambre droite ou d'hypertension pulmonaire) doit être effectué. En cas de constipation, un lavement baryté ou une manométrie peuvent être envisagés pour exclure une HSCR à segment court. Les patients diagnostiqués après la période néonatale seraient appelés LO-CCHS et peuvent être distingués des autres syndromes d'hypoventilation alvéolaire légère par la présence d'un PHOX2B mutation.

Le génotype 20/24 est probablement sous-diagnostiqué en raison de l'hypoventilation subtile et du besoin potentiel de cofacteurs environnementaux (17) ou de la condition homozygote pour manifester le phénotype CCHS (66). Analyses moléculaires de PHOX2B dans des cohortes d'individus présentant une hypoventilation profonde après une anesthésie, une sédation ou une maladie respiratoire peuvent identifier des patients supplémentaires avec les génotypes 20/24 et 20/25. Ce faisant, d'autres facteurs environnementaux ou génétiques non encore identifiés qui pourraient avoir un impact sur la pénétrance variable des mutations 20/24 et 20/25, ainsi que la nouvelle mutation faux-sens la plus récemment décrite (81), peuvent être déterminés.

Il est essentiel que les praticiens distinguent LO-CCHS de l'obésité d'apparition rapide avec dysfonctionnement hypothalamique, hypoventilation et dysrégulation autonome (ROHHAD) (86), une maladie rare décrite pour la première fois en 1965 (87). Appelé à l'origine syndrome d'hypoventilation centrale d'apparition tardive avec dysfonctionnement hypothalamique (88), il a été renommé en 2007 (86) pour alerter le praticien sur la séquence typique de présentation des symptômes. Dans cette même publication, Ize-Ludlow et ses collègues ont clarifié que le ROHHAD est un syndrome nettement différent du CCHS, comme le démontrent les antécédents soigneux et PHOX2B essai. Bien que moins de 55 enfants aient été décrits dans la littérature avec ce trouble (86, 88, 89), il est essentiel de reconnaître le phénotype distinct de l'ESCC. Les enfants atteints de ROHHAD présentent généralement entre 1,5 et 7 ans une obésité d'apparition rapide (gain de 20 à 40 livres sur 4 à 6 mois), suivie de la reconnaissance d'autres troubles hypothalamiques, notamment un déséquilibre hydrique, des taux élevés de prolactine, une altération de l'apparition de la puberté , et plus. Près de la moitié des enfants connaîtront un arrêt cardiorespiratoire après une infection virale intercurrente, puis des apnées obstructives du sommeil et une hypoventilation seront notées. À des moments variables par la suite, des symptômes de dérégulation autonome, notamment une température corporelle basse, des mains et des pieds froids, une bradycardie sévère, une diminution de la perception de la douleur, entre autres, deviendront apparents. À tout moment de la manifestation de la maladie, jusqu'à 40 % des enfants présenteront une tumeur d'origine de la crête neurale, souvent associée à une scoliose. Les troubles du comportement, le strabisme et les réponses pupillaires anormales sont tous rapportés dans ROHHAD. Ces enfants peuvent souvent être pris en charge avec une ventilation au masque uniquement la nuit, mais un sous-ensemble d'entre eux nécessitera une ventilation 24 heures sur 24 par trachéotomie. Bien que des études en cours sur les causes possibles de ROHHAD soient en cours, la cause spécifique de ce trouble n'a pas été identifiée. Comme il n'y a pas de test génétique disponible pour ce trouble, le diagnostic de ROHHAD est basé sur la présentation clinique, les caractéristiques cliniques associées et l'absence documentée d'autres diagnostics potentiellement confusionnels, y compris l'exclusion d'un CCHS avec PHOX2B tests (documentation d'une absence de PARM et de NPARM).

La plupart des mutations d'expansion se produisent de novo dans l'ESCC, mais 5 à 10 % sont hérités d'un parent en mosaïque généralement non affecté. Une distinction est nécessaire entre l'hérédité germinale et l'occurrence somatique de la PHOX2B mutation. Une pénétrance incomplète a été démontrée lorsque certains PHOX2B des mutations sont présentes dans toutes les cellules (y compris les cellules reproductrices de la lignée germinale) d'individus connus pour ne pas être affectés. Ces derniers PHOX2B les mutations (20/24, 20/25 et quelques NPARM), bien qu'asymptomatiques chez certains individus, peuvent être caractérisées par des effets phénotypiques plus légers ou variables chez les enfants atteints de CCHS ou d'autres membres de la famille (3, 5, 17), respectivement . En revanche, un mosaïcisme somatique, dû à des mutations postzygotiques, a été signalé chez un sous-ensemble de parents de cas typiques de l'ESCC porteurs PHOX2B allèles polyalanine (PA) supérieurs à 25 répétitions et NPARM (3, 6, 7, 16).

Le mosaïcisme somatique pour un PARM a été signalé pour la première fois en 2003 par Weese-Mayer et ses collègues (3) chez 4 parents sur 54 familles disponibles (7,4 %). En 2005, Trochet et ses collègues (6) ont identifié un mosaïcisme somatique chez 1 parent de chacun des 10 patients atteints de CCHS, confirmant qu'environ 10 % des enfants atteints de CCHS hériteront de la mutation d'un parent mosaïque. Dans les deux études, le mosaïcisme a été détecté dans l'ADN extrait des leucocytes périphériques des parents en observant un signal plus léger de l'allèle étendu que de l'allèle normal, contrairement au schéma observé chez les sujets atteints de CCHS.

Une estimation quantitative du mosaïcisme somatique chez les parents non affectés a récemment été évaluée dans deux autres études. Les produits d'amplification d'ADN de porteurs asymptomatiques d'expansions d'alanine avec des génotypes allant de 20/25 à 20/31 ont été chargés sur un séquenceur automatisé d'ADN et étendus, et les allèles normaux ont été visualisés (Figure 5) sous forme de pics de sortie dont la zone sous-jacente était directement proportionnelle à leur montants respectifs. Bien que le pic de mutant soit censé représenter 50 % de la PHOX2B allèles chez les individus qui ont hérité de la mutation, il s'est avéré qu'elle variait de 9 à 35% dans l'ADN des leucocytes parentaux, ce pourcentage a été confirmé dans des études sur l'ADN des fibroblastes et de la salive d'un sous-ensemble de ces parents mosaïques (13). De même, dans une autre étude, les individus en mosaïque ont été identifiés comme des « valeurs aberrantes », avec moins de signal dans le pic correspondant à l'allèle élargi (16). Alors que le mosaïcisme somatique pour les PARM supérieurs à 20/25 a été démontré dans ces études, aucun des rares porteurs 20/25 apparemment asymptomatiques ne s'est avéré être mosaïque, confirmant que dans ces cas, l'absence du phénotype de la maladie peut être attribuée à une pénétrance réduite d'un mutation germinale (13, 16). Prises ensemble, ces données soutiennent l'hypothèse que les PARM de lignée germinale plus grands que le génotype 20/25 sont entièrement pénétrants et que les porteurs asymptomatiques ne peuvent être trouvés qu'en association avec des degrés significatifs de mosaïcisme somatique.Le phénotype CCHS n'a été associé à aucun degré de mosaïcisme somatique jusqu'à présent, suggérant une origine germinale pour la plupart des PARM chez les patients atteints de CCHS.

Figure 5. Quantités différentielles de type sauvage et expansé PHOX2B allèles chez les porteurs de mutation PA. Bleu les pics représentent le PHOX2B allèles portés par un patient atteint du syndrome d'hypoventilation centrale congénitale (CCHS) (supérieur) et un parent asymptomatique (bas). Bien que les positions sur l'axe des x correspondent à leurs longueurs, comme indiqué ci-dessous, la hauteur des pics est directement proportionnelle à leur montant. Dans cette optique, l'individu ci-dessous présente un mosaïcisme somatique pour l'allèle 26 Ala (génotype 20/26) qui correspond en fait à bien moins de la moitié par rapport à l'allèle 20 Ala sauvage (génotype normal 20/20).

Détection du même PHOX2B La mutation dans les paires parent-enfant et l'observation du mosaïcisme somatique chez certains parents non affectés pour la mutation observée chez leur enfant affecté ont clairement établi un mode de transmission autosomique dominant pour l'ESCC (3, 6). La plupart des parents d'enfants atteints de CCHS ne sont pas porteurs du tout d'une mutation, ce qui indique une forte de novo taux de mutation chez les individus atteints. Les PARM de génotype 20/24 et 20/25 et certains des NPARM peuvent être trouvés dans la lignée germinale de parents asymptomatiques d'enfants atteints de CCHS et même d'autres membres de la famille, suggérant que ces mutations sont héritées comme dominantes avec une pénétrance incomplète (5, 7, 10 , 11, 13, 17, 26). Les membres de la famille qui portent de telles mutations mais n'ont pas de CCHS peuvent présenter d'autres phénotypes de TSNA, y compris une HSCR ou un neuroblastome (7, 48), ou peuvent être présymptomatiques, se présentant plus tard dans l'enfance ou à l'âge adulte.

Le conseil génétique est crucial pour les personnes diagnostiquées avec le CCHS, leurs parents et, dans certains cas, certains membres de la famille. Pour tous les individus atteints de CCHS, il y a 50 % de chances de transmettre la mutation, et donc le phénotype de la maladie, à chaque progéniture. S'il s'avère qu'un parent non affecté est en mosaïque pour un PHOX2B mutation (généralement identifiée en raison d'un enfant atteint), il y aura jusqu'à 50 % de chances de récidive chez tout enfant suivant. Les individus mosaïques peuvent toujours être supposés avoir une nouvelle mutation (la mutation ne peut pas être héritée de manière mosaïque) et, par conséquent, seuls les enfants de ces individus (pas les autres membres de la famille) seraient à risque d'avoir la mutation. Si les parents non affectés sont porteurs d'une mutation germinale (c'est-à-dire un PARM de génotype 20/25), de nombreux autres membres de la famille peuvent être porteurs de la même mutation sans présenter de symptômes évidents. Dans ce cas, les tests génétiques sont indiqués pour toutes les personnes en position dans le pedigree pour hériter de la mutation, qui peut souvent être retracée jusqu'à ce que l'individu à l'origine de la mutation soit identifié. Pour évaluer le risque de récurrence dans une famille, les deux parents d'enfants atteints d'ESCC devraient avoir la PHOX2B Test de dépistage effectué pour exclure un mosaïcisme (90) (PARM des génotypes 20/26 à 20/33 et NPARM sévère) ou un état de porteur non pénétrant (Génotypes 20/24 et 20/25 PARM et NPARM léger). Des tests prénataux sont disponibles et peuvent être effectués pour les personnes avec ou sans CCHS qui sont connues comme porteuses de mutations germinales ou reconnues comme mosaïques somatiques. Malgré les tests négatifs des parents d'un enfant de l'ESCC, un mosaïcisme de la lignée germinale ne peut être exclu et des tests prénatals pour les grossesses ultérieures doivent être envisagés. Les tests prénatals peuvent fournir aux parents des informations optimales pour prendre une décision éclairée avec une gamme de possibilités allant de l'avortement électif à une salle d'accouchement entièrement préparée pour optimiser les chances du bébé de passer en douceur à la vie extra-utérine.

Les faisceaux de polyalanine, prédits dans environ 500 protéines humaines, se trouvent préférentiellement dans les facteurs de transcription et sont considérés comme des éléments espaceurs flexibles essentiels à la conformation, aux interactions protéine-protéine et/ou à la liaison à l'ADN. tracts PA codés par des gènes humains, autres que PHOX2B, ont déjà été trouvés étendus en association avec au moins neuf troubles congénitaux différents, y compris un retard mental et des malformations du cerveau, des doigts et des structures médianes (91). Dans cette optique, les expansions PA sont membres d'une catégorie plus large de troubles associés à la répétition des trinucléotides qui comprend également les expansions polyglutamine (PQ). Contrairement aux tracts PQ, les étirements PA sont généralement stables (ne changent pas de taille lorsqu'ils sont transmis d'une génération à l'autre), sont généralement codés par des répétitions de trinucléotides imparfaites (l'alanine peut être codée par quatre triplets d'ADN différents) et, à l'exception de rares contractions , ne sont pas présents sous forme de faisceaux polymorphes dans la population humaine (la plupart des gènes de type sauvage ont tous le même nombre d'alanines). Ces observations ont suggéré une recombinaison homologue allélique inégale (croisement) pendant la méiose et/ou la mitose comme le mécanisme pathogène le plus attrayant pour les expansions des voies poly-A (91).

Cependant, chez les individus mosaïques, seuls deux allèles (type sauvage et allèles étendus), au lieu des trois allèles (type sauvage, contracté et étendu) attendus après la survenue d'un événement somatique de croisement inégal, ont été rapportés, démontrant qu'un mécanisme mutationnel alternatif devrait être envisagé pour expliquer l'origine de ces expansions répétées de trinucléotides (16, 92). En effet, en raisonnant que des séquences répétées de trinucléotides imparfaites, typiques des tracts PA, réduiraient la capacité des répétitions à former des structures désalignées, le glissement de réplication a été proposé comme un mécanisme plus plausible que le croisement inégal pour la génération d'expansions PA (93) .

Cette vue a été récemment révisée après avoir observé quatre familles informatives pour PHOX2B marqueurs dont la ségrégation était compatible avec la survenue d'échanges inégaux de chromatides sœurs. Il est probable que de novo l'expansion des répétitions PA dans l'ESCC résulte principalement de ce type d'événement chromosomique soit pendant la gamétogenèse, soit dans les cellules somatiques postzygotiques (94).

Une origine paternelle des gamètes transmettant des expansions a été rapportée dans six de novo trios CCHS (94), alors que dans une cohorte plus importante de 20 trios, 13 mutations se sont produites sur les chromosomes paternels et 7 sur les chromosomes maternels. Ainsi, l'occurrence d'expansions répétées d'AP peut être indépendante des processus spécifiques au développement des spermatozoïdes ou des ovocytes, ou il se peut qu'il existe un faible biais sexiste qui nécessiterait l'analyse d'un échantillon plus large de trios parent-enfant.

En tant que facteur de transcription tissu-spécifique, PHOX2B est responsable de la régulation de l'expression d'une série de gènes cibles impliqués dans le développement du SNA. La découverte que PHOX2B se lie directement aux régions régulatrices de la dopamine-β-hydroxylase (??H), PHOX2A, et TLX-2 gènes a permis l'application d'une approche fonctionnelle pour révéler les mécanismes moléculaires sous-jacents à la pathogenèse du CCHS. À cette fin, PHOX2B les mutations ont été testées pour une perturbation potentielle de la fonction normale de la protéine en ce qui concerne (je) transactivation de différents promoteurs cibles, (ii) liaison à l'ADN, (iii) formation d'agrégats, et (iv) localisation subcellulaire. Mécanismes pathogéniques distincts de l'ESCC pour les PARM et les NPARM dans PHOX2B ont ainsi été postulés. De plus, la réponse cellulaire à PHOX2B Les expansions de polyalanine ont été étudiées pour déterminer s'il existe des mécanismes cellulaires qui pourraient être ciblés pour limiter la cytotoxicité de ces mutations.

Pour étudier comment PHOX2B Les expansions de PA peuvent induire la pathogenèse du CCHS, la capacité des constructions d'expression contenant des mutations de PA à réguler la transcription de gènes cibles connus a été comparée, dans deux laboratoires différents, à un type sauvage PHOX2B construction. En particulier, comme illustré sur la figure 6A pour le gène cible DβH, lorsque mutant PHOX2B les constructions ont été cotransfectées avec le DβH et PHOX2A régions de régulation reliées à la Luciférase gène, une corrélation inverse stricte entre l'activité luciférase induite et la longueur du tractus PA a été identifiée. Cela suggère que la régulation transcriptionnelle de ces deux gènes dépend directement de la structure correcte du domaine PHOX2B, y compris le tractus 20-alanine et que les tracts plus longs perturbent de plus en plus la transcription (6, 18). Enfin, une réduction significative de l'activité transactivatrice des constructions PHOX2B portant différentes contractions de PA sur le promoteur DβH a également été observée dans le même test rapporteur (72). Malheureusement, cette observation n'a pas pu être reproduite dans un autre receveur de cellules (6), ce qui suggère la nécessité d'une enquête supplémentaire avant d'évaluer si, malgré l'absence de tout effet phénotypique, les contractions de PA entraînent une certaine perturbation de PHOX2B fonction.

Figure 6. Effet de PHOX2B mutations sur la transactivation de la ??H région de régulation. L'activité transcriptionnelle obtenue en cotransfectant le PHOX2B constructions d'expression signalées sur la gauche de chaque diagramme avec une construction contenant le ??H promoteur cloné en amont du Luciférase le gène rapporteur est montré pour les deux (UNE) étendues poly-Ala expansées et (B) mutations de décalage du cadre de lecture en termes d'activité relative de la luciférase. Adapté avec la permission de la référence 18.

La microscopie à fluorescence de cellules COS-7 exprimant des protéines PHOX2B fusionnées à une molécule fluorescente verte a montré que la protéine PHOX2B de type sauvage est présente presque exclusivement dans le noyau. Cependant, l'augmentation de la longueur de la répétition PA induit un pourcentage croissant de protéine PHOX2B dans les cellules à se localiser à tort dans le cytoplasme (figure 7) (18). Ainsi, des expériences similaires réalisées dans des cellules HeLa ont induit la formation d'agrégats de polyalanine PHOX2B, bien qu'en quantités différentes par rapport à celles observées dans les cellules COS-7 (6), suggérant que la mauvaise localisation de la protéine mutante est un mécanisme pathogénique courant conduisant à une altération de l'activité transcriptionnelle. du mutant PHOX2B contenant des voies d'AP expansées sujettes à l'agrégation.

Figure 7. Localisation subcellulaire de protéines portant différents défauts PHOX2B. Dans les panneaux de droite, trois modèles possibles de localisation cellulaire PHOX2B sont signalés : (N) localisation nucléaire uniquement (N+C) localisation à la fois nucléaire et cytoplasmique, soit diffuse, soit avec formation d'agrégats nucléaires et/ou cytoplasmiques et (C) localisation cytoplasmique uniquement. La distribution subcellulaire des protéines PHOX2B-GFP, après transfection cellulaire avec des constructions mutantes portant différentes mutations PHOX2B, est rapportée dans les histogrammes de gauche : 25Ala, 29Ala, 33Ala (dessus) et c.930insG, c.614–618delC (au dessous de). Adapté avec la permission de la référence 18.

De plus, sur la base d'essais de déplacement de mobilité électrophorétique, il a été observé que les expansions contenant 29 alanines et plus affectent la liaison à l'ADN de PHOX2B, probablement parce que les protéines mutantes PHOX2B agrégées ne sont pas disponibles pour la liaison à l'ADN, une observation confirmée in vitro en montrant que les protéines PHOX2B expansées par PA forment spontanément des oligomères (6). Enfin, l'interaction entre la protéine PHOX2B de type sauvage et le mutant à 33 répétitions mal repliées a suggéré que les mutations PA peuvent également empêcher la protéine normale de sa fonction habituelle en raison d'une agrégation anormale avec le mutant (6, 18).

Dans la tentative d'évaluer le sort des cellules exprimant PA-expanded PHOX2B, in vitro des expériences ont démontré que l'activation de la réponse au choc thermique par le médicament geldanamycine, un antibiotique naturel, est efficace à la fois pour empêcher la formation et pour induire la clairance des agrégats de PA préformés PHOX2B et, finalement, également pour sauver la capacité de PHOX2B à transactiver le promoteur DβH. De plus, l'élimination des protéines mutantes PHOX2B par le protéasome et l'autophagie, deux mécanismes cellulaires déjà connus pour être impliqués dans la clairance des protéines contenant des tracts polyglutamine et polyalanine expansés, a été démontrée. L'apoptose cellulaire n'a été observée qu'en association avec les plus grandes expansions d'AP (19).

Les protéines PHOX2B non-PA mutantes testées jusqu'à présent ont montré une activation transcriptionnelle compromise des promoteurs DβH et TLX2 avec une perturbation de l'activité plus sévère corrélée à la longueur de la séquence C-terminale décalée (voir Figure 6B pour l'effet sur la cible DβH) (6, 18, 95). De façon inattendue, PHOX2B des mutations de décalage du cadre de lecture ont montré une activation accrue de 10 à 30 % de la PHOX2A région de régulation (18). De plus, les décalages du cadre de lecture et les mutations faux-sens ont principalement montré une perte complète de la liaison à l'ADN mais, contrairement aux longues expansions de PA, sont capables de se localiser correctement dans le noyau (Figure 7) (6, 18).

Des régions C-terminales aberrantes peuvent provoquer un dysfonctionnement de la protéine PHOX2B en raison soit d'un manque de capacité à établir des interactions protéine-protéine correctes avec des partenaires moléculaires, soit de l'acquisition de la capacité d'interagir avec de mauvaises molécules, une hypothèse très attrayante à la lumière de l'association des mutations NPARM avec risque de développement d'un neuroblastome (96). De manière constante, une étude récente a montré que les mutants non-PA PHOX2B les constructions ont conservé la capacité de supprimer la prolifération cellulaire sans pouvoir promouvoir la différenciation (20), suggérant un mécanisme qui pourrait favoriser le développement de tumeurs de la crête neurale.

En conclusion, ces études ont indiqué une différence marquée entre les PARM et les NPARM à décalage du cadre en termes de transactivation des promoteurs cibles, de formation d'agrégats et de localisation subcellulaire. Futur in vitro l'enquête fournira d'autres indices sur la pathogenèse et d'éventuelles indications thérapeutiques.

Avant la découverte de 2003 qui PHOX2B est le gène définissant la maladie pour le CCHS, le spectre clinique de gravité en termes d'hypoventilation et d'autres aspects du phénotype ANSD a longtemps intrigué les cliniciens. Une fois le diagnostic de CCHS envisagé, du sang doit être envoyé pour PHOX2B Test de dépistage (voir Figure 8 ). Dans le cas où le test de dépistage est négatif et que le phénotype du patient appuie le diagnostic de CCHS ou LO-CCHS ou que le médecin/la famille souhaite écarter complètement le diagnostic de CCHS, alors la séquelle PHOX2B Un test de séquençage doit être effectué (disponible au Children's Memorial Hospital, Chicago, IL pour des options supplémentaires, veuillez vous référer à www.genetests.org). Ce test en deux étapes est le plus rentable (la mutation dans 95 % des cas de l'ESCC sera identifiée avec la méthode peu coûteuse PHOX2B Test de dépistage et seul un sous-ensemble des NPARM nécessitera le PHOX2B Test de séquençage à identifier). En attendant les résultats de l'étude cliniquement disponible PHOX2B les tests (sensibilité et spécificité élevées) d'autres causes d'hypoventilation doivent être exclus pour accélérer une intervention appropriée et faciliter les stratégies de traitement pour les soins à domicile. Une maladie pulmonaire primitive, une faiblesse des muscles ventilatoires et une maladie cardiaque doivent être exclues avec les tests suivants : radiographie thoracique et potentiellement TDM thoracique, évaluation neurologique complète et potentiellement biopsie musculaire et échocardiogramme, respectivement. Les lésions anatomiques brutes causales du cerveau/du tronc cérébral doivent être exclues par une IRM et/ou une tomodensitométrie du cerveau et du tronc cérébral (97, 98). De même, les erreurs innées du métabolisme doivent être prises en compte et un dépistage métabolique doit être effectué.

Figure 8. Électrophorèse sur gel de polyacrylamide PHOX2B Test de dépistage. Montré sont PHOX2B mutations d'expansion des répétitions de polyalanine (PARM) par taille de répétition de polyalanine et non-PARM (NPARM) pour le syndrome d'hypoventilation centrale congénitale (CCHS) le plus courant PHOX2B génotypes identifiés avec le PHOX2B Test de criblage par rapport au produit de type sauvage (pistes 3 et 15). Les pistes 1 à 2 indiquent les résultats pour les NPARM avec de grandes délétions : 722del35 et 722del38. Les pistes 4 à 14 indiquent l'analyse de plusieurs PARM, y compris les parents mosaïques (génotype 20/26 et 20/27) ainsi que les proposants (génotypes 20/24 à 20/33). Les pistes 7 et 9 sont des supports en mosaïque de PARM causant l'ESCC. La piste 7 est un parent mosaïque du proposant identifié dans la piste 6. La piste 9 est un parent mosaïque du proposant identifié dans la piste 8. Notez que l'intensité de la bande de l'allèle étendu est beaucoup plus légère que celle de l'allèle de type sauvage dans les pistes 7 et 9. Notez également que bien que l'intensité globale du signal dans la piste 8 soit faible, les bandes étendues et de type sauvage sont toutes deux d'intensité similaire indiquant un porteur complet de l'allèle à 27 répétitions étendue. Reproduit avec la permission de la référence 41.

Indépendamment des anomalies du contrôle respiratoire, les enfants atteints de CCHS ont d'autres preuves d'un dérèglement autonome diffus (27, 28). Pour les personnes présentant des symptômes de constipation, un lavement baryté ou une manométrie et une biopsie rectale potentiellement complète doivent être effectuées pour diagnostiquer la HSCR (99). L'imagerie thoracique et abdominale en série est essentielle chez les enfants atteints de NPARM et les enfants de génotype 20/29 à 20/33 pour l'émergence d'une tumeur de la crête neurale, en particulier le neuroblastome (NPARM) et le ganglioneuroblastome/ganglioneurome (PARM) (100). Étant donné qu'aucun enfant de génotype 20/24 à 20/28 n'a été identifié avec des tumeurs d'origine de la crête neurale, la valeur de l'imagerie en série dans ces cas est inconnue. Des anomalies du rythme cardiaque, notamment une diminution de la variabilité de la fréquence cardiaque d'un battement à l'autre, une arythmie sinusale respiratoire réduite et des asystoles brusques transitoires, ont été décrites (9, 101, 102). Une surveillance Holter de soixante-douze heures effectuée chaque année peut déterminer des rythmes cardiaques aberrants, des pauses sinusales qui nécessiteront l'implantation d'un stimulateur cardiaque bipolaire (103) et la fréquence des pauses plus courtes (c'est-à-dire moins de 3 s) qui peuvent avoir un impact physiologique et neurocognitif. Les enfants atteints de CCHS sont à risque d'hypertension pulmonaire progressive et de cœur pulmonaire en raison d'une hypoxémie récurrente due à des réglages de ventilateur ou à un calibre de trachéotomie inadéquats, à une hypoventilation non reconnue pendant la respiration spontanée pendant l'éveil, à un exercice excessif avec un compromis physiologique résultant ou à une conformité sous-optimale à la ventilation artificielle. En conséquence, les échocardiogrammes, les hématocrites et la numération des réticulocytes effectués tous les 12 mois fourniront des informations sur le cœur pulmonaire et la polyglobulie potentiels, avec des tests effectués plus fréquemment si cela est cliniquement indiqué et justifié. Les patients atteints de CCHS présentent fréquemment des anomalies ophtalmologiques reflétant le rôle de PHOX2B sur les nerfs crâniens contrôlant la fonction pupillaire (23, 29). Des tests ophtalmologiques complets détermineront la nature de l'implication ophtalmologique et permettront des stratégies d'intervention pour éviter toute interférence avec l'apprentissage. Des rapports anecdotiques de faible tolérance à la chaleur et de transpiration abondante ont été décrits (1) mais n'ont pas été étudiés de manière exhaustive. Une évaluation formelle très limitée du SNA a été rapportée, et aucune n'a été analysée par PHOX2B génotype.Des tests autonomes complets, comme indiqué cliniquement, pour évaluer la syncope et la fonction du système nerveux autonome peuvent inclure des tests d'inclinaison, une respiration profonde, une manœuvre de Valsalva, des facteurs de stress thermique, une pupillométrie, etc., à mesure que de nouvelles mesures de tests autonomes sont développées pour les nourrissons et les enfants.

Des performances scolaires sous-optimales et/ou une diminution de la fonction intellectuelle ont été observées chez les patients de l'ESCC (23, 104-107). On ne sait pas si cela est dû à une hypoxémie due à une assistance ventilatoire inadéquate ou à un résultat direct du problème neurologique principal associé à l'ESCC. À mesure que les enfants atteints de CCHS sont identifiés de manière plus cohérente au cours de la période néonatale et que la prise en charge de ces enfants complexes et vulnérables devient plus standardisée, une amélioration des performances neurocognitives est attendue avec une distinction entre les séquelles de l'hypoxémie (dues à l'hypoventilation ou aux asystoles) et la maladie innée spécifique au CCHS . Des tests neurocognitifs complets effectués chaque année dans un cadre contrôlé évalueront les progrès de l'enfant par rapport à l'intervention, à la gestion et à l'observance et peuvent identifier les domaines d'intervention. Les enfants atteints de l'ESCC ont un bel avenir avec les patients les plus âgés identifiés comme nouveau-nés qui obtiennent leur diplôme universitaire, se marient et conservent leur emploi. Il incombe à la famille et au personnel médical de fournir une oxygénation et une ventilation optimales pour assurer la maximisation du potentiel neurocognitif. Une intervention éducative agressive associée à une gestion ventilatoire et cardiovasculaire soigneuse est essentielle (23, 104-107).

Dans la situation idéale, les soins aux personnes atteintes de CCHS seraient fournis par des centres possédant une vaste expertise en CCHS, travaillant en étroite collaboration avec les pneumologues pédiatriques et les pédiatres régionaux. Cet arrangement améliorera davantage la cohérence de la gestion et, idéalement, améliorera le niveau de résultat pour les personnes atteintes d'ESCC. Bien qu'il puisse y avoir une résistance à l'orientation vers de tels centres, les auteurs de la déclaration ATS notent que de nombreux pneumologues pédiatriques extrêmement compétents gèrent essentiellement les enfants atteints de CCHS comme ils le feraient avec d'autres patients avec trachéotomie et ventilateurs. Ils voient les patients à des intervalles variables allant de 4 à 12 mois, ne vérifient les mesures physiologiques que pendant 5 minutes éveillé dans la clinique, ne prennent pas d'antécédents de médecine autonome, ne révisent pas la technologie à la maison ou l'accès à l'alimentation et aux soins d'urgence, pas réévaluer la taille de la canule de trachéotomie après la période néonatale, ne pas passer d'une tubulure de ventilation néonatale à une tubulure pédiatrique, ne pas éduquer les parents sur la gestion de la ventilation et l'utilité de la surveillance non invasive, ne pas préconiser que tous les parents soient dépistés avec le PHOX2B Test de dépistage pour vérifier le mosaïcisme, et plus encore. Essentiellement, ce sont des praticiens extrêmement compétents mais occupés qui n'ont pas le temps ou intensif expérience pour se concentrer sur les nuances essentielles à une prise en charge réussie des enfants atteints d'ESCC et de leurs familles. L'objectif est d'accepter que s'occuper d'enfants atteints de CCHS est un privilège qui nécessite une profondeur de soins qui n'est pas typique pour d'autres patients atteints de troubles pulmonaires plus courants. Il n'y a tout simplement pas assez de temps pour que le pneumologue pédiatrique (qui jongle avec les patients atteints de fibrose kystique, de maladie pulmonaire chronique, d'asthme, etc.) pour accorder une attention approfondie aux besoins d'un enfant atteint du CCHS. En raison de la nature du PHOX2B mutations, et la gamme de phénotypes basés sur ces mutations, l'expérience avec même 15 à 30 patients ne commence pas à fournir l'étendue de l'expérience nécessaire pour comprendre les besoins de l'enfant atteint du CCHS.

L'hypoventilation alvéolaire est la marque de fabrique de l'ESCC et sa caractéristique phénotypique la plus apparente et potentiellement débilitante. De manière caractéristique, la diminution du volume courant avec un effet résultant sur la ventilation minute est plus apparente dans le sommeil non-REM dans l'ESCC, mais elle est également anormale pendant le sommeil paradoxal et l'éveil, bien qu'habituellement à un degré plus modéré (23, 108, 109). Le spectre des troubles respiratoires du sommeil peut varier en sévérité de l'hypoventilation pendant le sommeil non paradoxal avec une ventilation adéquate pendant l'éveil, à l'apnée complète pendant le sommeil et à l'hypoventilation sévère pendant l'éveil. Le phénotype de l'ESCC relatif aux besoins ventilatoires est PHOX2B dépendant du génotype/de la mutation. Typiquement, les enfants avec le génotype 20/27 à 20/33 et les NPARM auront besoin de 24 heures par jour de ventilation mécanique. Les enfants avec les génotypes 20/24 et 20/25, et un petit sous-ensemble de NPARMs, nécessitent rarement 24 heures par jour de ventilation à moins qu'ils n'aient eu une gestion ventilatoire sous-optimale pendant des périodes prolongées dans la petite enfance. Les besoins ventilatoires éveillés des enfants avec le phénotype 20/26 varieront avec le niveau d'activité. On ne sait pas encore si la respiration spontanée pendant l'éveil s'améliorera avec la puberté.

L'incidence de l'ESCC dans la population générale est inconnue, bien que l'incidence variera probablement selon l'origine ethnique sur la base des statistiques actuelles (∼ 90 % des sujets identifiés sont de race blanche dans l'examen des rapports publiés et dans les communications personnelles des laboratoires des membres de la ad hoc Comité des déclarations). Étant donné que les individus ayant les génotypes 20/24 et 20/25 ont une expressivité variable et peuvent ne pas se présenter à des soins médicaux avant d'avoir reçu une sédation ou d'avoir une maladie pulmonaire grave, il incombe à la communauté médicale d'identifier ces patients avant d'être confrontés à une -situation menaçante. Ce qui est évident, c'est que l'incidence de l'ESCC n'est plus aussi rare que prévu au moment de la première déclaration de l'ATS sur l'ESCC en 1999 (1). La détermination d'une incidence réelle nécessitera une vaste étude basée sur la population dans tous les groupes ethniques.

Les résultats des rapports sur les réponses ventilatoires et d'éveil éveillé et endormi (108, 110-112), la concentration mentale (34), les sensations respiratoires (35, 36), la réponse physiologique à l'exercice et au mouvement des jambes (32-35, 113, 114) , et les anomalies focales sur l'IRM fonctionnelle (115–118) doivent être interprétées avec prudence car elles reflètent probablement un biais dû à la petite taille de l'échantillon, rapportant dans le pré-PHOX2B ère, présentation des données incluant les sujets avec ESCC et avec d'autres causes d'hypoventilation (108), ou sans documentation de PHOX2B confirmation de l'ESCC chez tous les sujets et inclusion quasi-exclusive d'enfants capables de maintenir une ventilation adéquate pendant l'éveil au repos (il est donc probable que presque tous les sujets avaient le génotype 20/25 sur la base du phénotype et des protocoles décrits). Jusqu'à ce que les études soient répétées dans de grandes cohortes comprenant un large éventail d'enfants et d'adultes avec les génotypes 20/24 à 20/33 ainsi que les NPARM, ces résultats peuvent représenter la physiologie des seuls patients atteints de CCHS les plus légers.

Études physiologiques complètes semestrielles puis annuelles à l'hôpital pendant les états d'éveil et de sommeil pour évaluer les besoins ventilatoires à différents niveaux d'activité et de concentration, à tous les stades du sommeil, avec respiration spontanée et avec ventilation artificielle, et la réactivité ventilatoire aux défis physiologiques endogènes et exogènes éveillé et endormi, déterminera les besoins de chaque enfant pour une gestion clinique optimale. Ces études, réalisées au cours d'une hospitalisation de plusieurs jours dans un centre possédant une vaste expérience de l'ESCC, permettront de bien comprendre les besoins en respiration spontanée ainsi qu'avec la ventilation artificielle par l'un des moyens décrits dans les sections qui suivent. Ces études physiologiques doivent inclure une surveillance constante par un personnel hautement qualifié et une surveillance audiovisuelle continue avec enregistrement continu (au minimum) de la pléthysmographie d'inductance respiratoire (thorax, abdomen, somme), ECG, saturation en hémoglobine, forme d'onde de pouls, dioxyde de carbone de fin d'expiration, état de sommeil la stadification, la pression artérielle et la température. Autres tests recommandés pour les personnes atteintes de PHOX2B L'ESCC à mutation confirmée est présentée dans le tableau 1.

TABLEAU 1. TEST RECOMMANDÉ POUR CARACTÉRISER LE PHÉNOTYPE DU CCHS

Définition des abréviations: PARM = mutation d'expansion de répétition polyalanine NPARM = mutation d'expansion de répétition non polyalanine (faux-sens, non-sens, décalage du cadre de lecture).

* Les nourrissons de moins de trois ans doivent subir des évaluations complètes tous les 6 mois.


Chez les insectes, la répétition Alanine se produit-elle sur la séquence d'homéodomaine de l'abdomen ou se produit-elle sur une séquence différente ? - La biologie

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: exprimé dans le tissu adipeux féminin entourant les spermothèques

L'expression a été examinée à quatre phases du stade embryonnaire 5. prd est initialement exprimé dans un motif semblable à un écart non périodique dans la partie antérieure, qui commence à se résoudre en bandes dans la phase 2, cependant, le motif à 7 bandes complet n'apparaît que pendant la phase 3. Le les rayures émergent entièrement raffinées, avec des rayures nettes et régulièrement espacées.

L'expression prd est enrichie chez les mâles adultes.

La transcription prd est réprimée par la protéine ectopique eve dans les embryons eve hs.PS. Le timing suggère qu'eve est un régulateur direct de la prd.

Les transcrits prd atteignent un pic aigu dans les embryons de 2 à 4 heures, diminuent rapidement et sont indétectables après 12 heures. Ils sont absents dans les ovocytes. prd est initialement exprimé avec une périodicité à double segment (7 bandes) mais passe au niveau du blastoderme cellulaire à un modèle de périodicité à un seul segment (14 bandes).

Un transcrit prd de 3,6 kb est observé en plus du transcrit de 2,5 kb dans l'ARN d'embryon de 0 à 4 h de mères hétérozygotes prd 4.

La protéine prd est exprimée dans les glandes accessoires mâles. Il est initialement exprimé à des niveaux élevés dans toutes les cellules glandulaires accessoires, mais les niveaux de protéines diminuent avec l'âge des mâles vierges. les niveaux de protéine prd diminuent plus rapidement dans les cellules principales que dans les cellules secondaires. Chez les mâles de 10 jours, la protéine prd n'est détectée que dans des cellules secondaires dispersées dans la région distale des glandes. L'accouplement augmente le niveau de protéine prd

s dans les cellules principales et secondaires des glandes.

La protéine prd est d'abord détectée dans la région antérieure des embryons très précoces et est ensuite limitée à une bande antérieure très étroite. Au cours de la cellularisation, des rayures en cloche (rayures 3-7) sont observées. L'ordre d'apparition des bandes est 4 et 7, suivis de 3 et 6, et enfin la bande 5 émerge. À ce stade, la bande antérieure se divise en deux. Au milieu de la cellularisation, la protéine prd a atteint des niveaux égaux dans toutes les bandes. Dans le même temps, l'accumulation préférentielle de protéine prd au niveau des marges postérieures génère un gradient au sein de chaque bande. Au cours de la seconde moitié de la cellularisation, l'expression se produit également dans un patch de cellules à l'extrémité dorsale antérieure de l'embryon et dans une huitième bande. À la fin de la gastrulation, le nombre de stries a doublé pour atteindre 14 en raison de la réduction des protéines au milieu des stries accompagnée d'une augmentation des protéines dans la région antérieure des stries. A la fin du stade d'extension de la bande germinale, l'expression dans les rayures a disparu. La protéine prd est exprimée dans la région de la tête, plus fortement dans le lobe maxillaire, mais aussi dans les lobes labiaux et mandibulaires et dans le clypeolabrum. La protéine prd est également détectée dans le SNC en développement dans 2-3 neurones spécifiques par hémisegment.


Classification des protéines Hox

Les protéines avec un degré élevé de similitude de séquence sont également généralement supposées présenter un degré élevé de similitude fonctionnelle, c'est-à-dire que les protéines Hox avec des homéodomaines identiques sont supposées avoir des propriétés de liaison à l'ADN identiques (à moins que des séquences supplémentaires ne soient connues pour influencer la liaison à l'ADN). Pour identifier l'ensemble de protéines entre deux espèces différentes qui sont les plus susceptibles d'être les plus similaires en fonction, des schémas de classification sont utilisés. Pour les protéines Hox, il existe trois schémas de classification différents : basé sur l'inférence phylogénétique, basé sur la synténie et basé sur la similarité de séquence. [20] Les trois schémas de classification fournissent des informations contradictoires pour les protéines Hox exprimées au milieu de l'axe du corps (Hox6-8 et Antp, Ubx et abd-A). Une approche combinée a utilisé des informations basées sur l'inférence phylogénétique des différentes espèces et a tracé les types de séquences protéiques sur l'arbre phylogénétique de l'espèce. L'approche a identifié les protéines qui représentent le mieux les formes ancestrales (Hox7 et Antp) et les protéines qui représentent de nouvelles versions dérivées (ou ont été perdues dans un ancêtre et sont maintenant manquantes dans de nombreuses espèces). [21]


Chez les insectes, la répétition Alanine se produit-elle sur la séquence d'homéodomaine de l'abdomen ou se produit-elle sur une séquence différente ? - La biologie

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: signalé comme ébauche de l'ectoderme procéphalique

Commenter: exprimé dans le tissu adipeux féminin entourant les spermothèques

L'expression a été examinée à quatre phases du stade embryonnaire 5. prd est initialement exprimé dans un motif semblable à un écart non périodique dans la partie antérieure, qui commence à se résoudre en bandes dans la phase 2, cependant, le motif à 7 bandes complet n'apparaît que pendant la phase 3. Le les rayures émergent entièrement raffinées, avec des rayures nettes et régulièrement espacées.

L'expression prd est enrichie chez les mâles adultes.

La transcription prd est réprimée par la protéine ectopique eve dans les embryons eve hs.PS. Le timing suggère qu'eve est un régulateur direct de la prd.

Les transcrits prd atteignent un pic aigu dans les embryons de 2 à 4 heures, diminuent rapidement et sont indétectables après 12 heures. Ils sont absents dans les ovocytes. prd est initialement exprimé avec une périodicité à double segment (7 bandes) mais passe au niveau du blastoderme cellulaire à un modèle de périodicité à un seul segment (14 bandes).

Un transcrit prd de 3,6 kb est observé en plus du transcrit de 2,5 kb dans l'ARN d'embryon de 0 à 4 h de mères hétérozygotes prd 4.

La protéine prd est exprimée dans les glandes accessoires mâles. Il est initialement exprimé à des niveaux élevés dans toutes les cellules glandulaires accessoires, mais les niveaux de protéines diminuent avec l'âge des mâles vierges. les niveaux de protéine prd diminuent plus rapidement dans les cellules principales que dans les cellules secondaires. Chez les mâles de 10 jours, la protéine prd n'est détectée que dans des cellules secondaires dispersées dans la région distale des glandes. L'accouplement augmente le niveau de protéine prd

s dans les cellules principales et secondaires des glandes.

La protéine prd est d'abord détectée dans la région antérieure des embryons très précoces et est ensuite limitée à une bande antérieure très étroite. Au cours de la cellularisation, des rayures en cloche (rayures 3-7) sont observées. L'ordre d'apparition des bandes est 4 et 7, suivis de 3 et 6, et enfin la bande 5 émerge. À ce stade, la bande antérieure se divise en deux. Au milieu de la cellularisation, la protéine prd a atteint des niveaux égaux dans toutes les bandes. Dans le même temps, l'accumulation préférentielle de protéine prd au niveau des marges postérieures génère un gradient au sein de chaque bande. Au cours de la seconde moitié de la cellularisation, l'expression se produit également dans un patch de cellules à l'extrémité dorsale antérieure de l'embryon et dans une huitième bande. À la fin de la gastrulation, le nombre de stries a doublé pour atteindre 14 en raison de la réduction des protéines au milieu des stries accompagnée d'une augmentation des protéines dans la région antérieure des stries. A la fin du stade d'extension de la bande germinale, l'expression dans les rayures a disparu. La protéine prd est exprimée dans la région de la tête, plus fortement dans le lobe maxillaire, mais aussi dans les lobes labiaux et mandibulaires et dans le clypeolabrum. La protéine prd est également détectée dans le SNC en développement dans 2-3 neurones spécifiques par hémisegment.


Méthodes

Insectes et matériaux

Anopheles gambiae Les moustiques (souche PEST) ont été élevés et maintenus dans une chambre environnementale à 26 °C, 85 % d'humidité relative, avec un cycle de lumière de 16 heures et un cycle d'obscurité de huit heures comprenant une période d'une heure crépuscule/aube ​​[18]. Les larves ont été nourries quotidiennement avec un mélange 2:1 de granulés de poisson : de la levure de bière finement broyée [19]. La DL-octopamine, la tyramine, la dopamine, la naphazoline, la clonidine, la sérotonine, la chlorpromazine, la cyproheptadine, la prométhazine, tous les sels de chlorhydrate et la tolazoline, un sel de benzylimidazoline, ont été obtenus auprès de Sigma-Aldrich. Le chlorhydrate de métoclopramide a été obtenu auprès de MP Biomedical. Les composés identifiés dans l'écran virtuel ont été achetés auprès de Princeton BioMedical, ChemDiv, Chembridge et Enamine et testés in vitro contre AgOAR45B exprimé dans le GloResponse™CRE-luc2P Lignée cellulaire rapporteur HEK293 et ​​dans les essais biologiques larvaires.

Analyse d'expression de AgOAR45A et AgOAR45B

L'ARN total a été isolé de cinq Un. Gambie stades immatures (L1-P), femelles et mâles adultes, têtes de femelles adultes uniquement et abdomen/thorax de femelle adulte à l'aide du kit RNeasy Mini (Qiagen). L'ARN traité à la DNase (Fermentas) a été utilisé pour générer de l'ADNc en utilisant Superscript III (Invitrogen) et oligo (dT12–20), selon les recommandations du fabricant. La PCR quantitative (qPCR) a été réalisée en utilisant SYBRGreen (ABI), un système ABI 7900 RT-PCR et 200 ng d'ADNc par échantillon, une concentration finale de 0,15 M de chaque amorce et une température d'hybridation de 60°C. Les ensembles d'amorces utilisés pour l'analyse de l'expression étaient : Ag10592 forward- CACCATCGAACACAAAGTTGACACTT Ag10592 reverse- CGAACGTAACGTCACGGCCA Ag45A&B forward- GGGTACGTCGTCTACTCAGCCCTC Ag45A reverse- TGTATCCGCAGCGTTAGCCGATTG Ag45B reverse- CGAGATTGTTCTTGCCACCTTTGG. La sous-unité 7 de la protéine ribosomale 40S (AGAP01592) a été utilisée comme contrôle interne. Les réactions pour chaque gène et pour le contrôle utilisé ont été réalisées en triple. Les niveaux d'expression relatifs de chaque gène ont été déterminés par le CT méthode, où l'expression relative est exprimée comme un facteur de différence par rapport aux femelles entières et exprimée comme 2 - ΔΔCT . La formule suivante a été utilisée : CT = CT(stade ou condition) − CT(Femmes) et CT = CT (gène d'intérêt) − CT (40S ARN).

Expression hétérologue du récepteur de l'octopamine AgOAR45B

L'ARN total a été isolé des têtes de femelles adultes âgées de trois jours à l'aide du RNeasy Mini Kit (Qiagen). L'ADNc a été synthétisé à l'aide de SuperScript III (Invitrogen) et utilisé comme modèle pour l'amplification par PCR du AgOAR45A et AgOAR45B gènes. Insertion des séquences codantes dans le sgf moi et pme Les sites I du vecteur pF9a CMV hRluc-neo (Promega) ont été réalisés par digestion d'un fragment amplifié par les amorces suivantes : Ag45forward-TAAAGCGATCGCCATGAACGAGTCGGAGTGTGCC Ag45Areverse-TTGTGTTTAAACTCTCGAGTCGGACAGGTCGA Ag45ACACACCACCCTGAC. Des amorces ont été construites sur la base de la séquence annotée du gène AGAP000045 (VectorBase, Protein ID : AGAP000045-PA et -PB [20].

GloResponse™CRE-luc2P La lignée cellulaire rapporteur HEK293 (Promega) a été maintenue en culture adhérente à 37°C, 5% CO2 dans du DMEM (Invitrogen) supplémenté avec 10% de sérum de veau foetal (Atlanta), et 50 mg/ml d'hygromycine B. La transfection des cellules a été réalisée à l'aide du kit Amaxa Nucleofector selon les instructions du fabricant.Des transfections témoins ont été réalisées en utilisant un plasmide pF9A avec le gène barnase (ribonucléase bactérienne) retiré comme suggéré par le fabricant (Promega). Des lignes stables ont été créées en appliquant 400 mg/ml de G418 pendant trois semaines. Des clones stables de AgOAR45B exprimant des cellules rapporteurs HEK293 ont été créés à travers deux cycles de clonage en dilution limite.

Dosage de l'AMPc

L'augmentation de l'AMPc intracellulaire a été contrôlée par une construction rapporteur CRE-luc dans des cellules HEK293 (Promega). Des lignées cellulaires stables ont été étalées à une densité de 4 x 104 cellules par puits dans des plaques d'essai blanches à 96 puits (Corning, Cat. #3917). Les cellules ont été immédiatement traitées avec les divers composés et remises dans l'incubateur pendant quatre heures avant d'être analysées. L'AMPc a été quantifié par la production de luciférase à l'aide du kit de dosage de la luciférase Dual-Glo (Promega) en suivant les instructions du fabricant. Les unités de luciférase ont été normalisées au nombre de cellules en utilisant la construction Rluc interne dans le plasmide d'expression pF9A.

Dosage du Ca++ intracellulaire

Lignées cellulaires stables exprimant AgOAR45A ou AgOAR45B ont été étalées dans des plaques d'essai à 96 puits à fond transparent et puits noirs (Greiner Bio-One, Cat. #655090) à raison de 4 x 104 cellules par puits. Les cellules ont été laissées à croître pendant la nuit avant d'être analysées. Les cellules ont été préchargées avec Fluo-4 NW (Molecular Devices) et effectuées selon les instructions du fabricant. La fluorescence a été surveillée avant et après l'ajout de composés à l'aide du Flexstation3 (Molecular Devices), à des intervalles de deux secondes pendant 120 secondes.

Mutagenèse dirigée de AgOAR45B

Les AgOAR45B gène a été sous-cloné dans un vecteur TA (Invitrogen), selon les instructions du fabricant. Mutagenèse dirigée de AgOAR45B a été réalisée à l'aide du Quick Change Lightning Kit (Agilent). Les amorces (IDT) ont été conçues pour introduire des changements d'acides aminés uniques (voir le fichier supplémentaire 1). Des doubles mutants ont été créés par deux cycles de mutagenèse. Les mutations ont été confirmées par séquençage automatisé (ND Genomics Core Facility). Les gènes mutants ont ensuite été excisés et déplacés vers le vecteur d'expression pF9A comme décrit ci-dessus.

Préparation membranaire et dosage de liaison au radioligand

Les cellules en flacons T75 ont été lavées avec 10 ml de PBS, éliminées par grattage, centrifugées à 500 g, puis remises en suspension dans 5 ml de tampon de lyse, Tris-Cl 50 mM pH 7,4. Les cellules ont été incubées sur de la glace pendant 10 min et homogénéisées avec un homogénéisateur Dounce avec 30 coups. L'homogénat et 5 ml de lavage avec du tampon de lyse ont ensuite été centrifugés à 23 000 g pendant 30 min à 4°C pour agglomérer les membranes brutes. Le culot résultant a été remis en suspension dans 50 mM Tris-Cl pH 7,4, 5 mM MgCl2, 0,5 mM EDTA pH 7,4 et quantifié par dosage micro BCA (Thermo).

Des essais de liaison de radioligands ont été effectués en utilisant de la 3H-Yohimbine pour déterminer l'affinité de liaison du récepteur d'octopamine avec différents composés. Des membranes isolées, 30 µg par puits, ont été incubées en présence de 16 nM 3 H-Yohimbine (American Radiolabeled Chemicals) dans du tampon de liaison, et diverses concentrations de composés. Le volume réactionnel final était de 125 ml par puits dans une plaque d'essai à 96 puits. Cent mM de clonidine ont été utilisés pour déterminer la liaison non spécifique dans chaque expérience. Après une incubation de deux heures, les membranes ont été recueillies et lavées sur des tapis filtrants, prétraitées avec 0,3 % de polyéthylèneimine (Sigma) en utilisant un collecteur à 96 puits Brandel et comptées dans un compteur Perkin Elmer Microbeta.

Essai biologique larvaire

Des courbes dose-réponse ont été faites pour déterminer la DL50 pour certains composés contre trois jours Aedes aegypti larves. Dix larves ont été placées dans chaque puits d'une plaque à 12 puits, chaque puits contenant une concentration différente de composé dans l'eau. Trois puits répétés ont été réalisés pour chaque expérience et les courbes ont été effectuées trois fois distinctes. Des puits témoins ont été inclus dans chaque expérience, qui ne contenaient que du DMSO dans l'eau. Les plaques ont été incubées 24 heures dans des conditions d'insectarium standard. La mortalité a été déterminée après 24 heures.

Flux de travail du projet

Un flux de travail computationnel-expérimental (voir le fichier supplémentaire 2), similaire à l'approche computationnelle décrite par Yarnitzky et al.[21] a été utilisé. La méthode était la suivante : 1) des modèles d'homologie, à la fois des conformations inactives (basées sur les antagonistes) et actives (basées sur les agonistes), ont été créés à l'aide de la méthode basée sur les fragments I-TASSER (Iterative Threading Assembly Refinement) [22-24] comme ainsi qu'entouré de lipides, d'eau et d'ions en utilisant la dynamique moléculaire visuelle (VMD) [25] 2) un écran virtuel préliminaire avec l'un des deux ensembles de tests composés (composés d'agonistes ou d'antagonistes GPCR dont l'activité sur AgOAR45B a été déterminée expérimentalement à l'aide d'un AgOAR45B reporter assay) a été effectuée et un ensemble de positions parmi les mieux classées a été choisie et utilisée dans les simulations MD avec les conformations de protéines actives (liaison agoniste) et inactives (liaison antagonistes) appropriées 3) Les simulations MD ont été effectuées jusqu'à ce qu'elles soient stables les positions des ligands ont été obtenues, puis un criblage virtuel supplémentaire avec l'ensemble de tests a été effectué sur chaque conformation de protéine résultante et les résultats ont été analysés manuellement. L'étape 3 a été répétée jusqu'à ce que les positions des ligands soient stabilisées dans la protéine même après dix nanosecondes (ns) supplémentaires de simulation 4) les conformations finales ont ensuite été utilisées pour construire des grilles qui ont été soumises à un criblage virtuel à l'aide de la bibliothèque ZINC et, 5) les composés résultants ont été analysés et des composés ayant des caractéristiques structurelles différentes ont été achetés et testés expérimentalement in vitro.

Modélisation d'homologie

Les conformations initiales inactives (basées sur les antagonistes) et actives (basées sur les agonistes) d'AgOAR45B ont été générées à l'aide du serveur en ligne I-TASSER [26]. Pour la conformation inactive, une structure a été obtenue qui a été construite sur la base de nombreuses conformations liées à l'antagoniste GPCR et liées à l'agoniste inverse, principalement une structure cristalline de2-récepteur adrénergique avec agoniste inverse partiel lié au carazolol [PDB:2RH1]. Pour la conformation active, une structure a été obtenue qui a été construite sur la base de la structure cristalline du2-récepteur adrénergique-Gs complexe protéique avec un agoniste de haute affinité lié à BI-167107 [PDB:3SN6]. Les deux conformations ont été obtenues en utilisant les réglages I-TASSER standard. Dans le cas de la conformation active d'AgOAR45B, 3SN6 (chaîne R) a été utilisé comme modèle pour générer le modèle. Les écarts quadratiques moyens (RMSD), en tant que mesure de la stabilité des protéines, ont été calculés à l'aide du VMD 1.9 RMSD Trajectory Tool [25]. AgOAR45B a une identité de séquence de 24% (35% de similarité) avec le2-récepteur adrénergique (voir fiche complémentaire 3). Les résidus du site actif ont été déterminés à partir de l'analyse du inactif et actif2-les structures cristallines des récepteurs adrénergiques et l'observation des résidus qui interagissaient ou avaient le potentiel d'interagir avec les ligands liés aux structures cristallines [27, 28]. L'identité de séquence du site actif est beaucoup plus élevée à 67 % (73 % de similarité).

Dynamique moléculaire

En utilisant VMD 1.9, chaque représentation virtuelle de la protéine a d'abord été intégrée dans une grande bicouche lipidique de 1-palmitoyl-2-oléoylphosphatidylcholine (POPC), éliminant tout lipide qui chevauchait la protéine. Le système protéine-membrane virtuelle a ensuite été solvaté avec des molécules d'eau TIP3P et neutralisé en ajoutant virtuellement du KCl jusqu'à 400 mM. Initialement, les paramètres CHARMM 27 [29] ont été attribués à toutes les molécules en utilisant VMD 1.9 pour permettre l'ajout de la bicouche lipidique, de l'eau et des ions. Cependant, une fois que chaque système virtuel (conformation active et inactive) a été préparé et que son ligand respectif (octopamine pour la conformation active et prométhazine pour la conformation inactive) était prêt à être ajouté, les paramètres AMBER gaff et ff03.r1 ont été attribués au ligand. et le reste des molécules, respectivement, en utilisant Amber 11 tleap [30–32]. Le champ de force AMBER a été choisi car il permet la génération de paramètres pour le ligand à l'aide du module antichambre [33]. Un pont disulfure a été ajouté entre les résidus de Cys93 et ​​Cys194, car ce pont existait également dans les modèles PDB.

Chaque système virtuel complet consistait en la conformation respective d'AgOAR45B intégré à une grande bicouche POPC avec 168 molécules lipidiques. Dans chaque système virtuel, tous les résidus étaient à l'état de protonation normal pour le pH physiologique. De plus, le système lié à l'antagoniste contenait 171 ions potassium, 204 ions chlorure et 22 525 molécules d'eau pour un total de 99 706 atomes (mesuré 95×96×128 Å), tandis que le système lié à l'agoniste contenait 172 ions potassium, 205 chlorure ions et 22 654 molécules d'eau pour un total de 100 077 atomes (mesurés 101 × 92 × 127 Å). Avant les simulations MD, les systèmes étaient équilibrés à l'aide de 120 cœurs de processeur comme suit : 1) MD des queues lipidiques pendant 500 picosecondes (ps) [pas de temps = 2 femtosecondes (fs)] avec la protéine, le ligand, les groupes de tête lipidique, l'eau et les ions conservés fixe 2) équilibrage des lipides, de l'eau et des ions pour 500 ps (pas de temps = 2fs) avec contraintes harmoniques sur la protéine et le ligand 3) équilibrage de l'ensemble du système pour 500 ps (pas de temps = 2fs) sans contraintes moléculaires. Après équilibrage, 20 à 30 ns de simulation MD ont été effectués à l'aide de 504 cœurs de processeur par incréments de deux à trois ns de 10 ns, avec un pas de temps = 2 fs et des données de trajectoire collectées toutes les 200 ps. Les étapes d'équilibration et de simulation ont été exécutées en utilisant NAMD 2.8 [34] sur le cluster de calcul haute performance Kraken [35].

Préparation d'écran virtuel

Tous les travaux de criblage virtuels ont été exécutés sur leurs modèles d'homologie respectifs « protéines uniquement » (c'est-à-dire, ne contenant pas de lipides, d'eau ou d'ions). Les protéines ont été préparées en exécutant d'abord le flux de travail de l'assistant de préparation de protéines [36, 37], puis des grilles ont été générées à l'aide de l'application Receptor Grid Generation de Glide, chacune trouvée dans Maestro de Schrodinger Suite 2011 [38]. Pour obtenir les poses initiales de ligand utilisées dans la génération de grille, chacune des conformations a d'abord été superposée dans PyMOL [39] avec les modèles supérieurs utilisés par I-TASSER pour leur création (2RH1 pour la conformation inactive et 3SN6 pour la conformation active) et les positions des ligands trouvés dans chacun des modèles ont d'abord été enregistrés dans un fichier PDB, puis ajoutés à l'aide du Maestro de Schrodinger Suite 2011 à leur conformation AgOAR45B respective (l'agoniste inverse partiel 2RH1 CAU a été utilisé pour la conformation inactive et l'agoniste 3SN6 30G a été utilisé pour la conformation active conformation) pour désigner le site actif de la protéine. Le ligand ajouté à chacun des modèles d'homologie a été utilisé comme centroïde de la grille, déterminant la zone dans laquelle les bibliothèques de composés doivent être ancrées. Aucune contrainte n'a été utilisée.

Criblage virtuel avec des ligands GPCR connus

Les conformations inactives et actives d'AgOAR45B avec les ligands ajoutés ont été utilisées pour construire les grilles, qui ont ensuite été exécutées dans un écran virtuel à l'aide du logiciel Glide de Schrodinger [40-43] contre des antagonistes et agonistes GPCR connus, respectivement. Les structures composées originales utilisées dans les deux ensembles de tests ont été téléchargées à partir du site Web PubChem du NIH. L'un des ensembles de tests contient des agonistes connus du GPCR : synéphrine, acide cinnamique, clonidine, déméthylchlordimeforme, dopamine, eugénol, histamine, naphazoline, noradrénaline, octopamine, phentolamine, sérotonine, tolazoline, transanéthole et tyramine. L'autre contenant des antagonistes connus des GPCR : rauwolscine, déméthylchlodimeforme, 8-hydroxymiansérine, amitriptyline, antazoline, chlorpromazine, cyproheptadine, désipramine, desméthylmiansérine, dihydroergotamine, gramine, imipramine, maroxépine, métoclopramide, propranzoline, propranzoline, prométhine, prométhine, yohimbine. Chacun des ensembles de tests a ensuite été préparé à l'aide du LigPrep de Schrodinger Maestro [44] pour générer différents états de protonation potentiels dans une plage de pH de 7 à 8, des tautomères et des conformations en anneau. Une fois que chacun des ensembles de test a été amarré à sa conformation AgOAR45B respective, les positions de pose supérieures pour l'antagoniste prométhazine et l'agoniste octopamine ont été enregistrées et ajoutées plus tard aux conformations inactive (liée à l'antagoniste) et active (liée à l'agoniste), respectivement. Ces conformations de protéines avec des ligands ancrés ont ensuite été utilisées comme position de départ pour les simulations MD.

Criblage virtuel avec bibliothèque ZINC

La bibliothèque utilisée dans l'amarrage contenait des composés de type médicament de la base de données en ligne ZINC [45]. Les composés ont été préparés à l'aide du LigPrep de Schrodinger Maestro pour générer différents états de protonation potentiels à un pH compris entre 5 et 9, des tautomères et des conformations en anneau. La bibliothèque finale contenait environ 12 millions de composés. Il a été divisé en cinq sous-bibliothèques (∼ 2,4 millions de composés par sous-bibliothèque) pour la première série de criblage virtuel à haut débit.

La bibliothèque a été criblée contre cinq grilles d'AgOAR45B (deux des conformations liées à l'antagoniste et trois des conformations liées à l'agoniste), construites à partir des positions des récepteurs après 20 ns de simulation MD chacune. Le criblage virtuel à l'aide de la bibliothèque ZINC a été effectué à l'aide du logiciel Glide de Schrodinger en trois étapes : 1) chacune des cinq sous-bibliothèques a été filtrée à l'aide d'un criblage virtuel à haut débit et les 30 000 meilleurs composés de chaque sous-bibliothèque ont été enregistrés et recombinés pour former une bibliothèque contenant 150 000 composés 2 ). score, les interactions pertinentes dans la poche du site actif et la diversité dans l'échantillonnage pour des tests supplémentaires.


DÉBRANCHÉ

Lisa Kay Robertson

Une thèse soumise à la Graduate Faculty of North Carolina State University

Dans le respect partiel des Exigences pour le degré de

Docteur en philosophie. La génétique

Dr James W. Mahaffey, président du comité consultatif,

Dr Michael D. Purugganan, membre du comité,

Dr Jonathan M. Horowitz, membre du comité, Sciences biomédicales moléculaires

Ce travail est dédié à ma formidable famille, dont l'amour et le soutien inconditionnels me permettent de relever tous les défis sur mon chemin.

À mon père, qui est mon inspiration constante et qui m'a tellement façonné à travers sa vie d'excellence, son caractère inébranlable et son désir éternel d'apprendre.

Je reconnais et remercie sincèrement le Département de génétique pour l'incroyable opportunité qu'il m'a offerte. Je suis très reconnaissant pour les conseils et les conseils de mon conseiller, Jim Mahaffey, et des membres de mon comité consultatif—Amy Bejsovec, Michael Purugganan et Jon Horowitz.

Je dois également remercier tous les membres du Mahaffey Lab, passés et présents, pour leur amitié et leur aide. En particulier, je remercie Kate Lingerfeld, Dana Bowling, Jamie Mahaffey et Mark Shepherd pour leurs efforts et contributions à ma recherche Muk Patel pour ses compétences moléculaires supérieures et sa mémoire de piège en acier Barbara Imiolczyk pour tous ses conseils et notre chef de laboratoire merveilleusement efficace Jennifer Hutchinson, pour tout ce qu'elle fait pour faire fonctionner le labo.

Je dois également exprimer ma gratitude aux membres des laboratoires Brown et Denell de l'Université d'État du Kansas pour leur généreux partage d'ADN, de protocoles Tribolium et de conseils sur la lutte contre les scarabées. Je remercie également Bijan Dey du laboratoire Campos de l'Université McMaster pour avoir partagé la paternité, les lignes de vol et les informations concernant déconnecté.

CHAPITRE UN : Introduction générale. 1

CHAPITRE DEUX : Gènes et développement des insectes HOM-C - Leçons de la drosophile et au-delà . 5

Introduction—Gènes Hom-C/Hox de la drosophile. 7

L'expression embryonnaire et les phénotypes mutants des peignes déformés et sexuels sont réduits chez la drosophile et le tribolium. 16

L'initiation de peignes déformés et sexuels réduit l'expression chez la drosophile. 22

Maintien de l'expression Dfd et Scr chez la drosophile. 23

Régulation post-traductionnelle du SCR. 26

Régulation entre les protéines HOM-C - Auto et régulation croisée de la DFD et de la SCR . 26

L'homéodomaine de la protéine Hom-C. 28

Fonction de la protéine Hom-C. 30

Spécificité fonctionnelle de l'homéodomaine Hom-C. 32

Interactions coopératives entre les protéines Hom-C et d'autres facteurs . 35

L'extradenticule est un cofacteur de la protéine Hom-C. 38

Le motif YPWM (hexapeptide) et la formation d'hétérodimères Exd/Hom-C. 41

L'homothorax forme un trimère avec les protéines Exd et Hom-C. 42

En tant que cofacteur, l'extradenticule est insuffisant pour expliquer pleinement la fonction de la protéine Hom-C. 42

Autres cofacteurs potentiels de la protéine Hom-C - cap'n'collar, lignées et apontique. 44

Co-facteurs potentiels de protéine de doigt de zinc C2H2. 45

L'objet de cette recherche. 48

CHAPITRE TROIS : Expression du gène de la drosophile déconnectée à l'aide du système UAS/GAL4

CHAPITRE QUATRE : Un réseau interactif de protéines à doigt de zinc contribue à la régionalisation de l'embryon de drosophile et établit les domaines de fonction de la protéine Hom-C. 81

Matériaux et méthodes . 86

Disco et Dfd sont requis pour spécifier l'identité maxillaire. 87

Tsh réprime Disco pendant le développement normal du segment du tronc. 90

Ectopic Disco modifie le développement du tronc. 95

Disco et Scr peuvent activer les gènes cibles Scr. 100

CHAPITRE CINQ : L'expression du géant du gène gap de la drosophile établit la limite du tronc gnathal via l'activation et le positionnement des facteurs de tagmose à doigt de zinc C2H2 déconnectés et du tee-shirt. 114

Matériaux et méthodes . 119

la distribution de l'ARNm disco est altérée chez les mutants de gènes de structuration à action précoce. 120

La distribution de l'ARNm de tsh est altérée chez les mutants gap. 125

Les altérations de l'expression disco et tsh chez les mutants gt suggèrent une transformation homéotique du segment labial. 129

L'expression des gènes homéotiques est altérée dans les embryons mutants gt. 136

tsh est nécessaire pour la transformation gnathale en tronc chez les mutants gt. 139

Antp n'est pas requis pour l'expression épidermique ectopique de la tsh dans les segments gnathal. 140

Le domaine gt antérieur fonctionne dans l'identité de segment, en plus de la segmentation. 142

La fonction du domaine gt antérieur chez la drosophile est similaire à celle de Tribolium. 145

gt expression établit la frontière gnathal/tronc via la régulation de tsh et disco. 146

CHAPITRE SIX : Caractérisation fonctionnelle de l'homologue déconnecté chez le coléoptère, Tribolium castaneum. 159

Matériaux et méthodes . 163

Isolement, structure et conservation évolutive du Tc'disco . 165

Tc'disco est exprimé dans les appendices au cours du développement embryonnaire. 167

Tc'disco est nécessaire pour la bonne structuration et l'élongation des appendices embryonnaires. 178

Tc'disco est requis pour la bonne structuration et l'élongation des appendices adultes. 181

Tc'Disco est membre d'une famille de doigts de zinc C2H2 conservés au cours de l'évolution. 182

L'expression embryonnaire de Tc'disco est similaire à l'expression embryonnaire de Dm'disco. 185

Tc'disco fonctionne dans le développement de l'appendice Tribolium. 188

Rôles possibles pour Tc'disco dans le développement de l'appendice Tribolium . 189

CHAPITRE SEPT : Résumé et perspectives. 199

Résumé et regard vers l'avenir. 200

Conclusions et suggestions pour les travaux futurs. 201

Tableau 1 : Les effets des gènes examinés sur l'accumulation d'ARNm disco. 121

Figure 1 : L'organisation moléculaire du complexe homéotique de la drosophile

Figure 2 : Conséquences phénotypiques des mutations de l'insecte Hom-C. dix

Figure 3 : Expression régionale du gène Hom-C dans les embryons de drosophile. 13

Figure 4 : Segments, Parasegments et compartiments. 15

Figure 5 : Structures de la tête larvaire de drosophile. 18

Figure 6 : L'homéodomaine de la protéine Hom-C. 31

CHAPITRE TROIS Figure 1 : Localisation de l'ARNm in situ embryonnaire de la disco endogène et de l'UAS-discoM expression . 73

Figure 2 : Images de microscopie à contraste de phase de préparations de cuticules de type sauvage et UAS-discoM, tatou-GAL4. 75

Figure 3 : Micrographies électroniques à balayage environnemental (ESEM) d'yeux composés comparant le type sauvage et l'UAS-discoC exprimer des individus. 77

CHAPITRE QUATRE Figure 1 : Disco et Dfd sont requis pour l'identité maxillaire. 88

Figure 2 : La transformation du tronc en gnathal est plus complète dans les embryons mutants tsh. 91

Figure 3 : Le rôle de la Tsh dans la distribution des ARNm disco. 93

Figure 4 : Les protéines Hom-C s'accumulent dans le registre approprié dans les embryons avec Dfd et Disco ectopique mais sans Tsh. 96

Figure 5 : La fermeture dorsale est bloquée par l'expression prd » disco . 98

Figure 6 : Ectopic Disco modifie les segments du tronc. 101

Figure 7 : Activation du gène cible Scr, PB, par disco exprimé ectopiquement et Scr. 103

Figure 8 : Une hiérarchie interactive des facteurs de transcription à doigt de zinc établit les types de segments tronc et gnathal/tête . 109

CHAPITRE CINQ Figure 1 : L'expression spatiale du disco est affectée par les mutations de hb, Kr et gt. 122

Figure 2 : accumulation d'ARNm de tsh dans des embryons mutants hb, Kr et gt. 126

Figure 3 : L'analyse des cuticules d'embryons mutants hémizygotes gt révèle l'homéose du segment labial. 131

Figure 5 : Les modifications sont l'expression du gène Hom-C/Hox dans gtQ292 embryons mutants

indiquent un changement homéotique de l'identité labiale. 138

Figure 6 : tsh est nécessaire pour l'homéose du segment labial chez les mutants gtQ292. 142

Figure 7 : Le géant du gène gap a à la fois des fonctions homéotiques et des fonctions de segmentation. 151

CHAPITRE SIX Figure 1 : La séquence protéique prédite pour Tc'Disco. 166

Figure 2 : accumulation d'ARNm de Tc'disco dans les embryons de Tribolium. 168

Figure 3 : Préparation des cuticules des pattes larvaires de Tc'disco RNAi. 172

Figure 4 : Préparation des cuticules des appendices de la tête larvaire Tc'disco RNAi. 175

Figure 5 : Tc'disco est nécessaire pour la bonne structuration et l'allongement des appendices adultes. 179

Figure 6 : Une analyse phylogénétique des régions à doigt de zinc de la famille de protéines Disco. 184

Figure 7 : Comparaison de l'accumulation de transcrits disco, au stade germband étendu, entre Drosophila et Tribolium. 186

Figure 8 : Un modèle possible pour la régulation et la fonction de Tc'disco dans le développement des appendices larvaires. 192

CHAPITRE SEPT Figure 1 : Modèles mécanistiques possibles pour le contrôle Hox/Zinc Finger de la transcription du gène cible. 204

CHAPITRE UN

Bien que des mutations dans le complexe homéotique de Drosophila melanogaster (la mouche des fruits) (Hom-C) aient été isolées auparavant, ce n'est qu'en 1978, dans un rapport d'Edward B. Lewis, que ces gènes ont été reconnus comme faisant partie d'un complexe de gènes requis pour bonne structuration antéro-postérieure de l'embryon de drosophile (Lewis 1978). D'autres travaux des laboratoires Kaufman et McGinnis ont porté à huit le nombre de gènes Hom-C identifiés (Kaufman et al. 1980) et identifié une séquence hautement conservée appelée l'homéobox. Cette séquence code pour un motif de liaison à l'ADN, appelé homéodomaine (McGinnis et al. 1984). Depuis, des recherches approfondies ont été menées sur la conservation et la fonction de ces facteurs de transcription chez de nombreuses espèces animales différentes (Reviews in McGinnis et Krumlauf 1992 Gellon et McGinnis 1998 Veraksa et al. 2000). Ces gènes (généralement appelés gènes Homeobox (Hox)) jouent un rôle crucial dans le développement embryonnaire et la structuration chez pratiquement tous les animaux, et sont probablement à la base de la diversité développementale et évolutive du règne animal (Castelli-Gair 1998 Hughes et Kaufman 2002 Prince 2002). Les gènes Hox codant pour ces protéines sont conservés dans un arrangement génomique en cluster qui est généralement colinéaire avec leurs domaines d'expression antérieur/postérieur. Également appelés gènes « sélecteurs » (García-Bellido 1977), les gènes Hox codent pour des facteurs de transcription censés réguler des cascades génétiques spécifiques pour conférer des identités régionales précises et uniques le long de l'axe corporel antérieur/postérieur. Étant donné que différentes protéines Hox sont capables de se lier à des séquences d'ADN cibles très similaires, et parfois identiques, il est probable que des cofacteurs jouent un rôle dans l'orientation de la spécificité fonctionnelle de la protéine Hox au cours du développement animal. Cependant, peu de ces cofacteurs ont été identifiés.

la fonction de disco pendant le développement embryonnaire, et comment les protéines disco codées fonctionnent-elles avec les protéines Hox pour diriger la structuration ? Deuxièmement, quels facteurs en amont régulent l'expression spatiale et temporelle de disco et disco-r au cours du développement embryonnaire ? Enfin, étant donné que des homologues disco se trouvent dans divers phylums animaux, tout comme les gènes Hox, la fonction de cofacteur Hox est-elle également conservée ? Ces questions sont examinées à l'aide des organismes modèles Drosophila melanogaster et Tribolium castaneum (le scarabée rouge de la farine).

Le chapitre suivant de ce travail donne un aperçu complet de la fonction de la protéine Hom-C/Hox chez la drosophile et d'autres insectes, et décrit les questions qui subsistent concernant la fonction de la protéine Hox. Voici la présentation des résultats de l'expression ectopique et de l'analyse génétique utilisées pour explorer la fonction disco chez la drosophile. L'expression disco est montrée pour définir les domaines dans lesquels Dfd et Scr peuvent fonctionner. disco a en outre montré qu'il avait un rôle de structuration embryonnaire régional dans le cadre d'un réseau interactif de protéines à doigt de zinc C2H2 qui comprend le gène de structuration du tronc et le cofacteur Hox du tronc, teashirt (tsh). Les résultats de ce travail conduisent à la proposition d'un modèle de fonction de la protéine Hox chez la drosophile dans lequel différentes combinaisons de protéines à doigt de zinc C2H2 exprimées régionalement et de protéines Hox confèrent des identités de segment spécifiques le long de l'axe du corps embryonnaire. Ensuite, les résultats d'un criblage des régulateurs en amont de disco et de tsh sont présentés, et le géant du gène gap (gt) s'avère être la clé pour définir les limites d'expression de ces deux gènes pour définir la limite gnathal/tronc embryonnaire de la drosophile. La régulation de disco et de tsh par Gt sous-tend un rôle d'identité de segment jusqu'alors non reconnu pour la protéine Gt dans son domaine d'expression antérieur. Enfin, l'identification et la caractérisation d'un homologue disco de Tribolium est présentée. Le modèle d'expression embryonnaire de la disco Tribolium est examiné et comparé à l'expression disco de Drosophila. Les fonctions de développement embryonnaire et adulte du gène Tribolium disco sont étudiées en utilisant l'interférence ARN parentale et larvaire, et les résultats révèlent un rôle important pour le gène Tribolium dans la structuration et l'élongation des appendices. Ce travail se termine par un résumé des travaux, des conjectures sur la conservation évolutive de la fonction disco, et des perspectives de travaux futurs.

Castelli-Gair, J. (1998). Implications de la régulation spatiale et temporelle des gènes Hox sur le développement et l'évolution. Int J Dev Biol. 42 : 437-444.

García-Bellido, A. (1977). Mutations homéotiques et ataviques chez les insectes. Amer. Zool. 17 : 613-629.

Gellon, G. et McGinnis, W. (1998). Façonner les plans corporels des animaux dans le développement et l'évolution par la modulation des modèles d'expression Hox. Essais biologiques 20(2) : 116-125.

Heilig, J.S., Freeman, M., Laverty, T., Lee, K.J., Campos, A.R., et al. (1991). Isolement et caractérisation du gène déconnecté de Drosophila melanogaster. Embo J 10(4) : 809-815.

Hughes, C.L. et Kaufman, T.C. (2002). Gènes Hox et évolution du plan corporel des arthropodes. Évolution et développement d'ampamp 4(6) : 459-499.

Kaufman, T.C., Lewis, R. et Wakimoto, B. (1980). Analyse cytogénétique du chromosome 3 chez Drosophila melanogaster: le complexe de gènes homéotiques dans l'intervalle chromosomique polytène 84 A-B. Génétique 94 : 115-133.

Lewis, E.B. (1978). Un complexe de gènes contrôlant la segmentation chez la drosophile. Nature 276(5688) : 565-570.

Mahaffey, J.W., Griswold, C.M. et Cao, Q.M. (2001). Les gènes de la drosophile déconnectés et liés à la disco sont redondants en ce qui concerne le développement de la tête larvaire et l'accumulation d'ARNm à partir de gènes cibles déformés. Génétique 157(1) : 225-236.

McGinnis, W. et Krumlauf, R. (1992). Gènes homéobox et structuration axiale. Cellule 68(2) : 283-302.

McGinnis, W., Levine, M.S., Hafen, E., Kuroiwa, A. et Gehring, W.J. (1984). Une séquence d'ADN conservée dans les gènes homéotiques des complexes Drosophila Antennapedia et bithorax. Nature 308 (5958) : 428-433.

Prince, V. E. (2002). Le paradoxe Hox : plus complexe(s) qu'on ne l'imaginait. Biologie du développement 249 (1) : 1-15.

Steller, H., Fischbach, K.F. et Rubin, G.M. (1987). Déconnecté : un locus requis pour la formation de voies neuronales dans le système visuel de la drosophile. Cellule 50(7) : 1139-1153.

CHAPITRE DEUX

Insecte

Gènes et développement—

Gènes et développement de l'insecte Hom-C - Leçons de la drosophile et

Au-delà

Lisa K. Robertson et James W. Mahaffey

Département de génétique Campus de l'Université d'État de Caroline du Nord Box 7614

Courriel : [email protected] [email protected] Téléphone au bureau : 919-515-5791

Téléphone du laboratoire : 919-515-5815 Télécopieur : 919-515-3355

LES GÈNES DE LA DROSOPHILE HOM-C/HOX

Le mot homéotique a ses origines dans le mot grec, homoios, qui signifie similaire. William Bateson a inventé le terme «homéose» en 1894 pour décrire une mutation qui transforme une structure à la ressemblance d'une autre, en particulier en ce qui concerne les systèmes répétés tels que les segments, les pétales/sépales/étamines, les vertèbres, etc. Dans la génétique de la drosophile, le terme est utilisé pour décrire une mutation qui fait qu'un segment perd son identité normale et prend l'apparence d'un autre segment. Il existe de nombreuses mutations homéotiques dispersées dans tout le génome de la drosophile, mais deux régions du bras droit du troisième chromosome sont uniques. Ces deux groupes de gènes homéotiques, le complexe Antennapedia (Ant-C) et le complexe Bithorax (Bx-C), sont désignés conjointement sous le nom de complexe homéotique (Hom-C) ou complexe de Hox (Figure 1). Les gènes Hom-C de la drosophile Ant-C sont labiaux (laboratoire), proboscipedia (pb), déformé (Dfd), Sex combs réduit (Scr) et Antennapedia (Antp) 1. Les gènes Hom-C de la drosophile Bx-C sont Ultrabithorax (Ubx), abdominal-A (abd-abdominal-A) et Abdominal-B (Abd-B). L'organisation génomique et les modèles d'expression régionaux de ces gènes sont colinéaires dans l'embryon de drosophile en général, le domaine d'expression d'un gène le long de l'axe antéro-postérieur du corps est en corrélation avec sa position génomique au sein des complexes.

Les gènes Hom-C/Hox agissent pour diriger des identités de segments spécifiques le long de l'axe corporel antérieur/postérieur de l'insecte, et la perte ou la mauvaise expression d'un gène Hom-C/Hox est souvent suffisante pour transformer des régions entières du corps en une identité segmentaire différente. Deux exemples de telles transformations homéotiques chez la drosophile sont illustrés à la figure 2. Sur la photo, on voit un gain de fonction du mutant Drosophila Antennapedia (Antp), dans lequel les antennes sont transformées en pattes. Une larve Antp en phase terminale de perte de fonction présente également une transformation des deuxième et troisième segments thoraciques vers une première identité. Sans aucun doute, Drosophila melanogaster est l'organisme le plus étudié en ce qui concerne les gènes Hom-C. Ces puissants facteurs de transcription ont été initialement identifiés et caractérisés chez la mouche des fruits, et une grande partie de ce que l'on sait de leur structure, de leur régulation et de leur fonction provient de ces études.

1 Notez que les noms de gènes de drosophile suivent une nomenclature standard - les gènes sont généralement nommés pour le phénotype mutant, et

Figure 2 : Conséquences phénotypiques des mutations de l'insecte Hom-C

Les mutations de perte de fonction (D, E) et les mutations de gain de fonction (B) dans les gènes Hom-C peuvent avoir des effets phénotypiques dramatiques chez Tribolium et Drosophila. Une micrographie électronique à balayage d'un type sauvage (A) et d'une tête de drosophile adulte mutante (B). L'activation ectopique d'Antp dans les antennes (ANT) provoque la transformation en une deuxième jambe thoracique (HOM LEG). Dans une larve de drosophile de premier stade de type sauvage (C), les trois segments thoraciques différencient le denticule caractéristique

motifs. Les premiers denticules thoraciques comprennent une ceinture principale (marquée d'une flèche) et une seconde petite zone de denticules appelée « barbe » (marquée d'un astérisque). La morphologie des premiers denticules thoraciques diffère de celle des deuxième et troisième segments, ces derniers étant plus petits et plus fins. Dans la cuticule d'une larve en phase terminale dépourvue d'Antp (D), les deuxième et troisième segments thoraciques sont transformés vers une première identité thoracique. Notez l'apparition d'une barbe dans la deuxième ceinture denticulaire thoracique (marquée par un astérisque), et le changement morphologique des deuxième et troisième denticules thoraciques vers un premier type thoracique (flèches). Fluorescent,

images déconvoluées d'un type sauvage (E) et d'un TcDfd1 /TcDfd1 larve mutante de Tribolium (F). Normal

les antennes (ANT), les mandibules (MN), les palpes maxillaires (MAX) et les palpes labiaux (Lab) sont visibles chez la larve de type sauvage. Chez une larve dépourvue de fonction TcDfd (F), les mandibules se transforment en antennes homéotiques (HOM ANT). Crédits photo : images Tribolium avec l'aimable autorisation de S.J. Brun. Images de tête de drosophile avec l'aimable autorisation de Fly Base (Drysdale et al. 2005) :

Les complexes HOX sont conservés chez pratiquement tous les animaux, tout comme les fonctions de structuration axiale et la relation colinéaire entre les modèles d'expression et l'arrangement génomique. Le coléoptère, Tribolium castaneum (coléoptère rouge de la farine) représente l'espèce d'insecte non drosophile la mieux caractérisée. De nombreuses études ont caractérisé les phénotypes mutants, les modèles d'expression et la structure génomique des gènes Tribolium HOM-C, faisant de cet insecte un excellent modèle pour des études comparatives avec la drosophile. Les deux sont estimés à environ 300 millions d'années d'écart de leur dernier ancêtre commun (Brown et al. 1999b). Comme dans la plupart des espèces animales (autres que la drosophile), les gènes Tribolium HOM-C sont regroupés en un seul complexe, différent des complexes fractionnés observés chez plusieurs espèces de drosophiles (Beeman 1987 Ferrier et Akam 1996 Davenport et al. 2000 Powers et al 2000 Cook et al. 2001 Negre et al. 2003). La taille des grappes HOM-C varie entre les deux espèces d'insectes. Par exemple, la portion du complexe Tribolium correspondant au Drosophila ANT-C est d'environ 279 kb, alors que la même région chez Drosophila comprend environ 439 kb (Brown et al. 2002).

Figure 3 : Expression régionale du gène Hom-C dans les embryons de drosophile

Figure 4 : Segments, parasegments et compartiments

à l'ectoderme. Les domaines d'expression du gène HOM-C peuvent se chevaucher dans l'ectoderme, mais leurs domaines d'expression dans le mésoderme viscéral s'excluent mutuellement (Treisman et al. 1989). Comme indiqué dans la discussion ci-dessous, l'expression du gène HOM-C dans le SNC est également fréquemment décalée, bien que de seulement la moitié d'un segment, de sorte que les limites d'expression sont parasegmentaires. Dfd est une exception, avec ses limites d'expression se déplaçant vers l'avant à la fois dans le mésoderme viscéral et le SNC (Martinez-Arias et al. 1987).

L'expression embryonnaire et les phénotypes mutants des peignes déformés et sexuels réduits chez la drosophile et le tribolium

Deux gènes Hom-C sont au cœur de cette étude : Deformed (Dfd) et Sex Combs Reduced (Scr). Leurs modèles d'expression et leurs phénotypes mutants sont bien caractérisés à la fois chez la drosophile et le tribolium, bien que les études sur la mouche des fruits soient plus complètes. Voici un bref résumé des connaissances actuelles concernant Dfd et Scr dans chacun de ces organismes.

La Dfd est nécessaire au bon développement des segments mandibulaires et maxillaires de la drosophile (Wakimoto et al. 1984), ainsi qu'à la spécification appropriée du destin cellulaire dans le cerveau embryonnaire (Hirth et al. 1998 Hirth et al. 2001). Les travaux de Wakimoto et Kaufman (1984) ont identifié l'exigence de Dfd dans la spécification de la tête embryonnaire. Le gène Dfd englobe environ 11 Kb, ayant cinq exons, qui produisent un seul transcrit de 2,8 kb et une protéine de 586 acides aminés (Regulski et al. 1987). Dfd est le premier gène Hom-C à être exprimé, la protéine étant d'abord détectable au stade du blastoderme cellulaire (Mahaffey et al. 1989). L'expression embryonnaire précoce de Dfd entoure l'embryon, englobant le sillon céphalique. Plus tard, une accumulation est détectée de manière transitoire dans les primordiums des lobes hypopharyngiens et dans le segment mandibulaire et maxillaire en développement. L'expression dans le SNC et le mésoderme est décalée en avant, de sorte que l'expression mésodermique et neurale est parasegmentaire. L'expression de Dfd est également présente dans les cellules entre la crête dorsale en développement et le lobe optique. Par la contraction tardive de la bande germinale, Dfd est fortement exprimé dans les cellules du sac frontal qui contribueront à l'œil larvaire/disques antennaux.

et ne parviennent pas à intérioriser pendant l'involution de la tête2. Structures céphalopharyngées perdues ou réduites comprennent les crochets buccaux, la pièce en H, les cirres maxillaires, les organes sensoriels maxillaires et des parties du complexe sensoriel antennaire-maxillaire. La figure 5 montre une représentation graphique de la tête larvaire de drosophile et de ses structures céphalopharyngées.

Un homologue de Dfd, TcDfd, a été cloné et caractérisé chez Tribolium (Brown et al. 1999a). Comme la drosophile, TcDfd est le premier gène Hom-C exprimé dans l'embryon en développement. En général, l'expression embryonnaire est similaire à celle des mouches, étant présente dans les segments mandibulaire et maxillaire, leurs appendices et la crête dorsale, mais contrairement à la drosophile, les transcrits TcDfd sont évidents dans la séreuse extra-embryonnaire. Au fur et à mesure que les appendices maxillaires et mandibulaires se développent, l'expression de TcDfd module, apparaissant plus faible dans les appendices mandibulaires.

La fonction embryonnaire de TcDfd a été étudiée en utilisant à la fois l'analyse génétique et l'interférence ARN (ARNi) (Brown et al. 2000). Contrairement à la drosophile, qui ne présente aucune transformation homéotique chez les mutants nuls Dfd, la perte de TcDfd chez Tribolium transforme les appendices mandibulaires en antennes et élimine les endites des coxopodites maxillaires (figure 2F). L'épuisement d'un homologue du Dfd, Of'Dfd, chez Oncopeltus fasciatus (insecte de l'asclépiade) entraîne la transformation à la fois du segment maxillaire et du segment mandibulaire vers l'antenne (Hughes et Kaufman 2000), et il a été suggéré que l'antenne peut représenter un « état fondamental » pour l'identité du segment gnathal (Stuart et al. 1991). Les différences observées entre les mutants de Drosophila Dfd et la perte de Dfd chez d'autres insectes peuvent cependant simplement refléter le fait qu'il n'y a pas d'appendices larvaires chez la drosophile. Les phénotypes des mouches et autres insectes peuvent donc toujours représenter des altérations développementales équivalentes, bien qu'il faille être prudent en interprétant tout phénotype comme « état fondamental », car il est probable que certains gènes de structuration soient encore présents pour influencer le développement des appendices.

La conservation de la fonction Dfd à travers les embranchements a été testée en exprimant ectopiquement TcDfd dans des embryons de drosophile en développement (Brown et al. 1999a). Il a été précédemment montré que la Dfd endogène exprimée de manière ectopique activerait automatiquement la transcription de la Dfd épidermique dans le

Figure 5 : Structures de la tête larvaire de drosophile

Les structures cuticulaires et céphalopharyngées de la tête larvaire de la drosophile et des premiers segments thoraciques. Abréviations, suivies de l'origine segmentaire : dw—aile dorsale, Acron latp—pièce en treillis (pont dorsal), Acron vb—pont vertical, Acron es—sclérite épipharyngée, Labral mt—dent médiane, Labral anso—organe sensoriel antennal, Antennal ppw -paroi pharyngée postérieure, intercalaire lp-processus latéral, mandibulaire vw-aile ventrale, mandibulaire tr-côtes en T, mandibulaire mh-crochet buccal, mandibulaire (pointe)/maxillaire (base) mxso-organe sensoriel maxillaire, maxillaire dmp-dorsal- papille médiale du mxso, Antennal dlp-papille dorsale-latérale du mxso, mandibulaire ci-cirre maxillaire, Maxillaire vo-organe ventral, Maxillaire ds-sclérite dentaire, maxillaire hs-sclérite hypostomal (pièce en H), Labial db-denticule ceinture, Thoracique db-a—première ceinture thoracique antérieure, Thoracique db-p—première ceinture thoracique postérieure, Thoracique ki—organes de Keilin, Thoracique bd—kolbchen ventral (organes à points noirs), Thoracique. (Jürgens et al., 1986, The Fly Base

région postérieure ventrale des segments labiaux, du tronc et abdominaux (Kuziora et McGinnis 1988). Le transgène TcDfd, piloté par un promoteur de choc thermique, était également capable d'activer la transcription Dfd endogène selon un schéma très similaire (Brown et al. 1999a). Il a également dirigé l'expression d'un élément autorégulateur Dfd, fusionné à LacZ. Enfin, l'expression de TcDfd, dans des embryons de drosophile dépourvus d'une protéine Dfd fonctionnelle, a pu partiellement sauver le phénotype embryonnaire nul Dfd et l'a fait dans la même mesure que l'expression ectopique du gène endogène. Ces études illustrent la forte conservation de la fonction entre les gènes Hom-C chez différentes espèces.

S'étendant sur environ 100 kb, Drosophila Scr code au moins quatre transcrits distincts dérivés de l'épissage alternatif de quatre exons (Andrew 1995). Une grande partie de la région régulatrice Scr est séparée de la région codante par le gène de segmentation ftz (figure 1). Les mutations affectant la fonction embryonnaire se situent en 5' du gène ftz, plus proche de l'unité de transcription Scr, tandis que les lésions semi-létales se situent en 3' du gène ftz, vers Antp (Pattatucci et Kaufman 1991 Pattatucci et al. 1991). Le produit protéique Scr est constitué de 417 acides aminés avec un poids moléculaire de 44 kDa (Andrew 1995).

Scr est un gène particulièrement intéressant, en ce qu'il contrôle l'identité des segments dans deux tagmes différents de l'embryon de drosophile : le segment gnathal labial et le premier segment du tronc thoracique adjacent. Les transcrits Scr sont d'abord détectés au début de la gastrulation et continuent d'être présents pendant le reste de l'embryogenèse (Martinez-Arias et al. 1987). Bien qu'en retard de 2 à 3 heures sur la localisation de l'ARN, l'accumulation de protéines suit le schéma des transcrits d'ARN, se trouvant dans tous les lobes labiaux et la moitié antérieure du premier segment thoracique (Mahaffey et Kaufman 1987). De plus, quelques cellules de la crête dorsale expriment également la protéine Scr. Lorsque la bande germinale commence à se contracter, la protéine Scr s'accumule dans le mésoderme viscéral de l'intestin moyen (Tremml et Bienz 1989 Reuter et Scott 1990). Scr s'accumule également dans les primordiums des glandes salivaires embryonnaires avant leur invagination, cependant, Scr est totalement absent après l'invagination des glandes en développement (Reuter et Scott 1990).

gènes, il n'y a pas de transformation homéotique larvaire du segment labial correspondant à l'absence de Scr. La perte de Scr élimine les structures générées par le segment labial—les glandes salivaires et le pont de la pièce en H (Panzer et al. 1992).

L'expression et la fonction de l'homologue Scr semblent conservées chez Tribolium (Curtis et al. 2001 DeCamillis et al. 2001). Le gène Cephalothorax (Cx) a une taille d'environ 22 Kb et contient trois exons. Cx est flanqué de TcDfd et TcFtz, comme chez la drosophile, et produit un seul transcrit de 1,9 Kb. Cx est exprimé lorsque le rudiment de la bande germinale se condense, dans l'ectoderme du parasegment 2 (postérieur maxillaire/antérieur labial). Au fur et à mesure du développement, les transcrits Cx s'accumulent fortement dans le mésoderme du premier segment thoracique, et à un moindre degré, dans le mésoderme des deuxième et troisième segments thoraciques. Lorsque les appendices commencent à se former, Cx est exprimé dans l'ectoderme des primordiums de l'appendice labial. Enfin, lorsque la bande germinale est complètement rétractée, des transcrits Cx sont présents à la base des appendices labiaux, dans quelques cellules du mésoderme mandibulaire, dans quelques cellules du compartiment postérieur du membre maxillaire, la partie dorsale antérieure du premier segment thoracique, et selon un schéma répété de façon segmentaire dans le système nerveux central en développement (Curtis et al. 2001).

L'analyse génétique et l'ARNi ont été utilisées pour étudier le rôle de l'homologue Scr, Cephalothorax (Cx), dans Tribolium. Il existe deux classes de mutations dans le gène Cx de Tribolium (Beeman et al. 1989 Curtis et al. 2001). L'ARNi a été utilisé pour déterminer ce qui est susceptible d'être le phénotype nul, et il s'agit d'une transformation du labium en antennes et d'une fusion du premier segment thoracique à la tête (Curtis et al. 2001). Il est intéressant de noter que la transformation du labium en antennes n'est observée chez les drosophiles adultes que lorsque pb et Scr sont retirés (Percival-Smith et al. 1997). La deuxième classe de phénotype Cx est plus compliquée, provoquant l'acquisition d'une identité maxillaire par le labium et une duplication du premier segment thoracique (Beeman et al. 1989). La raison de cette transformation n'est pas encore claire.

l'expression sont létales et accompagnées de défauts morphologiques grossiers, et même lorsque des adultes viables sont produits, la fitness peut être grandement affectée. Par conséquent, un contrôle spatial et temporel strict des gènes sélecteurs Hom-C est essentiel à la structuration normale du corps.

La structure génomique groupée et l'expression colinéaire des gènes Hom-C sont plutôt uniques dans leur forte conservation à travers les phylums. Cela soulève la question : pourquoi les gènes Hom-C/Hox se trouvent-ils dans des arrangements si hautement conservés, et est-ce une exigence pour leur expression et leur fonction ? Des études chez les vertébrés révèlent des régions régulatrices Hox partagées et indiquent que des changements dans l'arrangement du complexe peuvent avoir un impact sur l'expression de plusieurs gènes Hox (Gould et al. 1997 Sharpe et al. 1998). Ces divisions dans le cluster Hom-C/Hox n'ont été observées (jusqu'à présent) que chez (Von Allmen et al. 1996 Adams et al. 2000 Negre et al. 2003 Negre et al. 2005) et chez le nématode, Caenorhabditis elegans ( Ruvkun et Hobert 1998), suggère une forte contrainte évolutive pour le cluster Hom-C/Hox ordonné, et peut-être un relâchement de cette contrainte dans ces deux organismes, dans lesquels les régions régulatrices du gène Hom-C partagées n'ont pas été identifiées. La conservation d'une organisation génomique ordonnée et groupée peut être nécessaire pour la colinéarité temporelle et spatiale observée dans l'expression de Hom-C (van der Hoeven et al. 1996 Kondo et Duboule 1999), bien que le mécanisme sous-jacent à cette exigence reste à déterminer. (Kmita et Duboule 2003). Malgré ces questions, certains mécanismes de régulation du gène Hom-C chez la drosophile sont compris.

Initiation de l'expression Dfd et Scr chez la drosophile

Dans l'embryon de drosophile, l'établissement de l'expression précoce de Hom-C se produit pendant le stade syncitial ou le stade précoce du blastoderme cellulaire et est contrôlé par les produits géniques de la brèche et de la segmentation précoces en amont. Plusieurs études ont démontré la régulation de l'expression de Dfd et Scr par ces produits géniques à action précoce et d'autres facteurs.

L'activité précoce de la Dfd n'est pas affectée de manière significative par les changements dans les gènes du trou zygotique, mais des mutations dans les gènes de la règle des paires affectent l'expression de la Dfd (Jack et al. 1988). Les mutations dans hairy, runt, even-skiped (eve), fushi tarazu (ftz), paired (prd), impair-paired (opa), impair-skiped (impair) et engrailed (en) affectent toutes l'expression Dfd. les mutants impairs et ftz permettent une expansion spatiale de l'expression de Dfd, indiquant une régulation négative de Dfd par ces produits géniques. Les mutants restants contractent l'expression de Dfd à des degrés divers, indiquant un rôle dans l'activation précoce de Dfd. Une certaine entrée de gène de trou dans la régulation Dfd a été signalée. Les embryons dépourvus du gène gap, sans queue (tll), présentent un patch ectopique transitoire de Dfd, juste avant son domaine d'expression normal dans l'anlagène du sillon céphalique, et ce patch est censé contribuer à l'élargissement de la crête dorsale au détriment de le lobe optique (Reinitz et Levine 1990). Cela peut se produire par l'action de ftz, qui est également mal exprimé dans les mutants tll. Jack et McGinnis ont exploré les effets combinatoires du gène d'effet maternel bicoid (bcd), du gène gap bossu (hb) et du gène pair-rule eve, sur l'expression de Dfd (Jack et McGinnis 1990). Dans leur modèle, la séquence régulatrice Dfd intègre trois niveaux de la hiérarchie de segmentation embryonnaire - une concentration intermédiaire du gène maternel, bcd en combinaison avec le gène gap, hb et les gènes pair rule eve et ftz - pour obtenir l'activation et le positionnement appropriés. du Dfd. Chacun de ces gènes code pour des facteurs de transcription, leur effet sur la transcription de Dfd peut donc être direct.

ont été proposés comme membres possibles d'un groupe de gènes Hox primordial (McGinnis et Krumlauf 1992 Macias et Morata 1996 Gallitano-Mendel et Finkelstein 1998).

Des travaux antérieurs suggèrent un rôle combinatoire pour les gènes de structuration précoce dans l'initiation de l'expression de Scr. Le gène de segmentation par règle de paire, ftz, s'est avéré nécessaire pour l'activation initiale Scr (Riley et al. 1987), et la perte de l'expression hb maternelle et zygotique affecte le placement spatial de l'expression Scr. Des travaux plus récents démontrent un rôle direct de l'Hb dans l'activation d'Antp, et les auteurs proposent que cela pourrait également être vrai pour la protéine gap, Giant (GT) dans l'activation de Scr (Wu et al. 2001).

Maintien de l'expression Dfd et Scr chez la drosophile

Le maintien de l'expression ou de la répression du gène de la drosophile Hom-C est nécessaire au-delà des premiers stades de l'embryogenèse, une fois que les premiers produits du gène de structuration se sont dissipés. Étant donné que les cellules continuent d'exprimer les gènes Hom-C selon des schémas restreints dans l'espace tout au long du développement, les cellules doivent « se souvenir » de leur état de transcription Hom-C pour éviter une activation inappropriée ou une perte de la fonction du gène sélecteur. Cette rétention à long terme de l'état de transcription Hom-C est prise en charge par deux grands groupes de protéines agissant en trans - le groupe Polycomb (PcG) (Simon 1995) maintient les gènes Hom-C dans un état réprimé, tandis que le groupe Trithorax ( TRX) (Ingham 1998) maintient les gènes dans un état actif. Les protéines du groupe TRX et du groupe PcG sont largement conservées entre la drosophile et les mammifères (Muller et al. 1995 Simon 1995).

formation d'une structure de chromatine d'ordre supérieur associée à la méthylation des histones (Cao et al. 2002). Les PRE n'ont pas de séquence d'ADN consensus reconnaissable spécifique (Jacobs et van Lohuizen 1999), et les protéines PcG sont probablement recrutées dans les PRE par les protéines répressives gap ou pair-rule, ou un autre intermédiaire de liaison à l'ADN.

Les protéines du groupe Drosophila Trithorax (TRX) jouent un rôle réciproque aux protéines PcG et maintiennent l'état transcriptionnel actif des gènes Ant-C et Bx-C (Breen et Harte 1993 Kennison 1993 Gindhart et Kaufman 1995). Le trithorax (TRX), l'homonyme et le membre le mieux caractérisé du groupe (Ingham et Whittle 1980 Ingham 1985), s'accumule selon un modèle modulé dans l'espace, en commençant par des rayures semblables à des règles de paire dans la partie postérieure de l'embryon. Cela peut réguler la transcription précoce de Bx-C (Sedkov et al. 1994), car les mutants trx ont modifié l'expression du gène Bx-C pendant l'extension de la bande germinale. Cependant, l'expression du gène Ant-C n'est pas altérée jusqu'aux derniers stades du développement. Il existe des allèles de trx qui affectent l'expression tardive du gène Ant-C sans effet sur l'expression de Bx-C, indiquant la présence de plusieurs produits, avec des rôles multiples, du locus trx. Des mutants nuls de trx imitent des mutations de perte de fonction dans les groupes Ant-C et Bx-C, produisant parfois des mouches avec six appendices thoraciques dorsaux d'identité semblable à une aile, le phénotype pour lequel le gène et le groupe sont nommés (Ingham 1998). Comme les protéines PcG, on soupçonne que le groupe TRX ne peut pas se lier directement à l'ADN, mais qu'il agit par l'intermédiaire d'autres protéines ayant une activité de liaison à l'ADN. Fait intéressant, l'analyse de la localisation des protéines PcG et TRX sur les chromosomes polytènes des glandes salivaires démontre que ces protéines se lient à bon nombre des mêmes régions chromosomiques, qui comprennent l'Ant-C et le Bx-C. Ainsi, l'interaction entre ces protéines régulatrices opposées sur les mêmes sites chromosomiques peut être importante pour leur fonction (Kuzin et al. 1994 Chinwalla et al. 1995). Une note finale importante : bien que ces complexes protéiques fonctionnent pour maintenir l'état d'activité initial du gène C dans une région particulière, les gènes Hom-C ne sont en aucun cas « bloqués » dans un état d'activité particulier pendant la durée du développement. Ceci est évident dans les modèles dynamiques d'expression observés pour les gènes Hom-C individuels au cours du développement et discutés plus tôt dans ce chapitre.

structures réduites des yeux et de la tête. Certains des défauts ressemblent aux défauts de la tête observés dans les allèles hypermorphes de Dfd, et les phénotypes mxc observés se sont avérés dépendants de la dose de Dfd. En l'absence de mxc, Dfd est exprimé de manière ectopique dans l'œil/disque antennal. Pris ensemble, les résultats soutiennent mxc en tant que régulateur de l'expression Dfd, nécessaire pour limiter l'expression Dfd dans l'œil/disque d'antenne. Deux loci Trx ont été identifiés dans un criblage de mutations qui ont amélioré la semi-létalité des allèles Dfd hypomorphes - kismet (kis) et snaggletooth (snt) (Gellon et al. 1997). Les deux sont des suppresseurs de la fonction Pc et provoquent une anomalie de la tête embryonnaire lorsqu'ils sont homozygotes. Fait intéressant, kis a été identifié à l'origine dans un criblage de modificateurs des mutations Pc et Antp, révélant que ce gène fonctionne en maintenant l'expression de plusieurs gènes Hom-C.

Deux régions spécifiques de la séquence régulatrice, une à 15 Kb en aval et une à 40 Kb en amont du site de démarrage de la transcription Scr, se sont avérées répondre génétiquement aux loci PcG et Trx pour effectuer l'expression de Scr au cours de l'embryogenèse et du développement imaginal ultérieurs (Gindhart et Kaufman 1995). Une séquence de 10 Kb située dans la région de 40 Kb a pu réprimer l'expression d'une construction de rapporteur Scr d'une manière dépendante de PcG et Trx. Deux gènes PcG, extra sex combs (esc) et Additional sex combs (Asc) sont nécessaires pour faire taire Scr dans les deuxième et troisième disques de la jambe thoracique (Pattatucci et Kaufman 1991). Un loci Trx, Brahma, s'est avéré nécessaire au maintien d'une expression correcte de Scr dans le premier disque imaginal de la jambe thoracique (Tamkun et al. 1992). Dorsal Switch Protein 1 (DSP1) est une protéine HMG de drosophile qui peut agir comme une protéine de groupe PcG ou de groupe Trx, selon le locus cible (Decoville et al. 2001). DSP1 s'est avéré spécifiquement impliqué dans la régulation spatio-temporelle de l'expression de Scr dans les premiers disques imaginaux thoraciques (Rappailles et al. 2004) Les auteurs ont pu localiser deux régions de 1 kilobase dans la séquence régulatrice de 10 kilobase, préalablement identifiée par Gindhart et Kaufman, qui interagissent directement avec DSP1. Le produit du gène trx joue un rôle dans le maintien à la fois de l'expression Dfd et Scr, ainsi qu'un certain nombre d'autres gènes Hom-C (Breen et Harte 1993). les mutants trithorax (trx) présentent une expression réduite, mais non absente, de Dfd et Scr - la réduction de l'expression est insuffisante pour provoquer des effets phénotypiques significatifs, suggérant que d'autres facteurs sont également à l'œuvre pour maintenir Dfd et Scr pendant la fin de l'embryogenèse.

de PS2 au milieu de l'embryogenèse (Henderson et Andrew 2000). Il est intéressant de noter qu'il s'agit d'une boucle de rétroaction dans laquelle le maintien de l'expression de Scr par hth conduit à l'inhibition de l'expression de hth par Scr et finalement à la perte de l'expression de Scr dans les primordiums des glandes salivaires.

Régulation post-traductionnelle de Scr

Toute la régulation du gène Hom-C ne se produit pas au niveau de la transcription. La fonction de la protéine Hom-C est également modulée après la traduction. Le bras N-terminal de l'homéodomaine est important pour la spécificité de la fonction de l'homéodomaine (discuté ci-dessous), et cette région de la protéine Scr est une cible pour une sous-unité régulatrice de la protéine phosphatase 2A spécifique à la sérine-thréonine (dPP2A, B' ) (Berry et Gehring 2000). L'état de phosphorylation de deux résidus clés dans la partie N-terminale de l'homéodomaine (Thr6 et Ser7) est essentiel à la fonction Scr. Ces résidus peuvent être phosphorylés par la kinase A dépendante de l'AMPc (PKA) et déphosphorylés par dPP2A dans des cellules en culture. L'expression ectopique d'une construction de protéine Scr imitant la déphosphorylation constitutive (avec Thr6 et Ser7 modifiés en alanine), reproduit le phénotype embryonnaire induit par l'expression ectopique de la protéine de type sauvage (perte de certaines structures de pièces buccales, formation de glandes salivaires ectopiques et transformation de les deuxième et troisième segments thoraciques vers une première identité thoracique). Inversement, une construction de protéine Scr exprimée de manière ectopique, dans laquelle les résidus Thr6 et Ser7 sont modifiés pour imiter la phosphorylation constitutive, est incapable de reproduire le phénotype Scr ectopique embryonnaire et a une capacité réduite à se lier à une séquence d'ADN cible in vitro. En outre, dPP2A,B' semble être requis pour la fonction Scr endogène, car les embryons dépourvus de dPP2A,B' ne parviennent pas à former des glandes salivaires.

expression épidermique dans les compartiments postérieurs des segments thoracique et abdominal (Pelaz et al. 1993). Fait intéressant, cette expansion dépend de niveaux modérés d'Antp ectopique (normalement réprimé par les protéines Bx-C), qui active Scr dans le contexte des segments postérieurs du tronc en l'absence des protéines Bx-C.

Dans deux études récentes, Miller et ses collaborateurs ont utilisé le système UAS-Gal4 (Brand et Perrimon 1993) pour étudier les relations embryonnaires de régulation croisée des gènes Hom-C (Miller et al. 2001a Miller et al. 2001b). Les gènes Hom-C démontrent des activités de régulation croisée spécifiques aux tissus. Par exemple, ectopic Scr et ectopic Dfd activent le pb dans l'ectoderme, ce qui est cohérent avec le rôle normal de ces protéines dans l'activation de l'expression du pb dans l'embryon (Rusch et Kaufman 2000). Dans le mésoderme, cependant, Scr ectopique réprime l'expression de pb (Miller et al. 2001a). La hiérarchie de la régulation croisée dans le SNC diffère également de celle de l'épiderme. Ectopique Ubx et Abd-A ne sont capables de réprimer que deux gènes Hom-C (Scr, lab) dans le SNC, tandis que Ubx et Abd-A ont des effets de régulation croisée plus importants dans l'épiderme. Miller et al. concluent qu'aucun modèle simple ne décrit de manière exhaustive les relations régulatrices entre les gènes Hom-C. Leurs interactions dans le SNC et le mésoderme sont plus complexes, et les cascades de signalisation contribuent probablement à cette complexité. L'évaluation de la relation entre la régulation autonome des cellules et la transduction du signal les a amenés à proposer une nouvelle relation hiérarchique dans le mésoderme, appelée « dominance autonome », dans laquelle la détermination extrinsèque du destin cellulaire via la signalisation peut être dépassée par l'expression des protéines Hom-C. .

Plusieurs éléments d'autorégulation Dfd spécifiques à une région ont été caractérisés qui maintiennent l'expression de Dfd d'une manière spécifique au tissu (Kuziora et McGinnis 1988 Bergson et McGinnis 1990 Regulski et al. 1991 Zeng et al. 1994).Ces éléments peuvent être situés en amont du promoteur ou dans des régions introniques. Par exemple, un élément d'autorégulation spécifique du SNC de Dfd est localisé dans le grand intron Dfd (Lou et al. 1995), tandis qu'un activateur épidermique réside en amont du promoteur Dfd (Bergson et McGinnis 1990 Zeng et al. 1994).

identité, comme en témoigne la perte partielle des structures des pièces buccales et la formation de glandes salivaires ectopiques (Zeng et al. 1993). Ainsi, Scr remplace la structuration normale dirigée par Dfd dans les lobes mandibulaire et maxillaire. Cela pourrait être dû à un niveau de Scr plus élevé que Dfd dans ces régions. Cependant, il n'y a pas d'effet phénotypique dans le tronc postérieur au deuxième segment thoracique. Ectopic Scr semble incapable de remplacer les fonctions endogènes d'Ubx, Abd-A et Abd-B, même si ces protéines sont probablement moins abondantes. De même, l'expression ectopique omniprésente d'Ubx provoque la transformation des segments antérieurs au premier abdomen, y compris le développement de denticules de type abdominal dans la tête et dans le thorax (Gonzalez-Reyes et Morata 1990), mais ces segments postérieurs au premier abdomen ne sont pas modifiés. Par conséquent, comme Scr, Ubx est incapable de remplacer la fonction Abd-A et Abd-B dans l'épiderme. Il existe cependant des violations du modèle de prévalence a posteriori. Par exemple, l'expression ectopique de Dfd est capable d'induire des crochets buccaux ectopiques dans le segment labial, de modifier la configuration des denticules du deuxième segment thoracique pour ressembler au premier segment thoracique et de produire des cirres sensoriels ectopiques et un matériel buccal sclérifié dans le tronc. segments (Kuziora et McGinnis 1988) altérant ainsi apparemment les modèles dirigés par les protéines Hom-C endogènes dans ces cellules.

LA PROTÉINE HOM-C HOMÉODOMAINE

Par exemple, Dfd et un homologue mammifère HoxD-4 (Hox-4.2), sont conservés dans l'homéodomaine à 55 des 60 résidus. L'expression de HoxD-4 chez la drosophile est capable d'activer un rapporteur sensible à Dfd dans les embryons et produit des phénotypes adultes similaires à ceux provoqués par un gain dominant de fonction allèle Dfd (McGinnis et al. 1990).

En plus des gènes Hom-C, il existe de nombreux autres gènes codant pour l'homéodomaine de Drosophila. Plusieurs sont bien étudiés et fournissent une grande partie de la base pour notre compréhension de la structure et de la fonction de l'homéodomaine. Des exemples particulièrement bien caractérisés incluent les gènes de segmentation engrailed (en) (Desplan et al. 1985 Desplan et al. 1988 Kissinger et al. 1990 Ohkuma et al. 1990 Jaynes et O'Farrell 1991 Ades et Sauer 1994 Clarke et al. 1994 Bourbon et al. 1995) et fushi tarazu (ftz) (Nelson et Laughon 1990 Percival-Smith et al. 1990 Florence et al. 1991 Walter et al. 1994), et le facteur maternel bicoïde (bcd) (Hanes et Brent 1989 Treisman et al. 1989 Hanes et al. 1994). Toutes les protéines Hom-C et d'autres protéines contenant un homéodomaine, y compris Even-skiped (Eve), Ftz et En, ont un résidu glutamine (Q) conservé à la position 50 de l'homéodomaine et sont appelées homéoprotéines Q50 (Biggin et McGinnis 1997).

les conclusions de ces études peuvent être raisonnablement appliquées aux gènes Hom-C restants et probablement à d'autres protéines d'homéodomaine Q50 également.

Les études entreprises pour caractériser la fonction homéodomaine comprenaient des interactions génétiques, des tests de transcription, des tests de réticulation ADN/protéine, des expériences d'immunoprécipitation et d'empreintes d'ADN. Les résultats de ces travaux ont caractérisé l'homéodomaine en tant que motif de liaison à l'ADN et les protéines Hom-C en tant que régulateurs transcriptionnels (Desplan et al. 1985 Müller et al. 1988 Krasnow et al. 1989 Samson et al. 1989 Johnson et al. 1995). En fait, l'homéodomaine est l'un des motifs de liaison à l'ADN les plus courants trouvés dans les régulateurs transcriptionnels eucaryotes, juste derrière la classe à doigts de zinc C2H2 (Tupler et al. 2001).

De nombreuses études de liaison à l'ADN in vitro avec les homéodomaines Hom-C ont abouti à la caractérisation d'une séquence de reconnaissance d'ADN consensus de base. Une première étude des interactions protéine Hom-C/ADN a utilisé la séquence de reconnaissance de l'homéodomaine Antp (Antp-HD), qui présentait une affinité de liaison à l'ADN spécifique pour la séquence 5'-TAATG-3' (Müller et al. 1988 Affolter et al. 1990 Ekker et al. 1991). D'autres études sur les interactions Hom-C/ADN impliquent des protéines Dfd, Antp, Ubx et Abd-B partielles ou complètes (Desplan et al. 1988 Müller et al. 1988 Affolter et al. 1990 Ekker et al. 1991 Ekker et al. 1992 Ekker et al. 1994 Wilson et al. 1995). Bien qu'Abd-B semble se lier préférentiellement à une séquence centrale légèrement différente de 5'-TTAT-3' (Ekker et al. 1994), les homéodomaines de la protéine Hom-C reconnaissent systématiquement une séquence centrale consensus de 5'-TAAT-3' dans des sites de reconnaissance caractérisés de 5 à 9 paires de bases.

Figure 6 : L'homéodomaine de la protéine Hom-C

bien que les protéines Hom-C reconnaissent et se lient à des séquences d'ADN spécifiques, il semble qu'elles puissent se chevaucher et que toutes reconnaissent la même séquence centrale. La conclusion est qu'il doit y avoir des mécanismes in vivo supplémentaires impliqués dans la direction de leurs spécificités de structuration biologique.

Spécificité fonctionnelle de l'homéodomaine Hom-C

En raison de la forte conservation des acides aminés et des similitudes apparentes dans la reconnaissance du site cible, plusieurs études ont tenté de disséquer les homéodomaines de la protéine Hom-C pour identifier des résidus spécifiques essentiels à leur fonction biologique. Plusieurs groupes ont abordé ce problème en construisant des protéines Hom-C chimériques (en échangeant diverses régions d'une protéine Hom-C contre une autre), puis en exprimant les chimères dans des embryons et des adultes de drosophile pour évaluer les résultats du développement et les effets sur l'expression des gènes cibles. Bien que ces types d'études aient impliqué la majorité des protéines Hom-C, je résume ci-dessous les résultats d'études d'échange sélectionnées impliquant l'homéodomaine Ubx, inséré dans la protéine Dfd (Kuziora et McGinnis 1989 Dessain et al. 1992 Lin et McGinnis 1992) et l'homéodomaine Scr, inséré dans la protéine Antp (Gibson et al. 1990 Furukubo-Tokunaga et al. 1993).

La substitution de l'homéodomaine Ubx en une protéine Dfd par ailleurs normale est suffisante pour introduire la régulation de la cible Ubx et annuler l'activité Dfd normale. Le Dfd de type sauvage peut autoréguler sa propre expression dans certaines cellules, se liant à des éléments autorégulateurs définis pour maintenir sa transcription (Kuziora et McGinnis 1988 Lou et al. 1995). L'activation ectopique de Dfd de type sauvage entraîne le développement de matériel buccal ectopique et de cirres maxillaires dans les segments du tronc, et l'autoactivation de Dfd en dehors de son domaine normal. L'activation d'une construction Dfd inductible par choc thermique chimérique, codant pour l'homéodomaine Ubx à la place de l'homéodomaine Dfd, entraîne une transformation des segments de la tête larvaire vers une identité thoracique, comme le résultat également l'expression ectopique d'Ubx (Gonzalez-Reyes et Morata 1990 ). L'activation ectopique d'Antp P1, une cible Ubx connue (Beachy et al. 1988), et la perte concomitante de l'autorégulation Dfd sont également observées (Kuziora et McGinnis 1989). Ainsi, la chimère Dfd/Ubx, avec seulement la région d'homéodomaine modifiée, modifie la fonction de la protéine pour ressembler à une construction de protéine Ubx de type sauvage.

une construction de protéine Dfd par ailleurs normale (Lin et McGinnis 1992). Chaque construction a été testée pour sa capacité à activer l'élément autorégulateur Dfd et le promoteur Antp P1. Les constructions conservant la région d'homéodomaine N-terminale d'Ubx conservent également la transformation de la tête larvaire en thoracique produite par la construction originale Dfd/Ubx et activent la transcription ectopique d'Antp P1. En outre, substituer seulement quelques résidus d'homéodomaine Ubx N-terminaux (numéros 0-9, voir figure 9) est suffisant pour modifier la fonction Dfd ectopique et permettre l'initiation de la transcription Antp P1 ectopique. Une chimère contenant l'homéodomaine Ubx avec la région d'homéodomaine Dfd N-terminale ne parvient pas à activer la transcription Antp P1 ectopique et perd la capacité d'induire une transformation de la tête au thorax. Les régions d'homéodomaine N-terminal et C-terminal sont nécessaires pour une autoactivation Dfd complète - aucune autoactivation n'est possible sans la région Dfd N-terminale et seule une autoactivation faible est possible avec la partie C-terminale absente. En résumé, ces études démontrent que l'homéodomaine est capable de diriger la fonction de la protéine Hom-C, et plus précisément, la région d'homéodomaine N-terminale à elle seule est suffisante pour modifier la fonction de la protéine Hom-C. La région flanquante C-terminale contribue également à la spécificité fonctionnelle.

D'autres ont adopté une approche similaire en comparant deux protéines Ant-C, Antp et Scr. Gibson et al. (1990) ont utilisé le degré de transformation et l'accumulation de transcrits du gène cible pour évaluer la spécificité fonctionnelle d'une série de protéines chimériques exprimées de manière ectopique. L'homéodomaine Scr a été substitué dans une construction de protéine Antp par ailleurs normale et la chimère a été exprimée dans des embryons et des adultes, en utilisant un promoteur de choc thermique inductible. Ce travail a déterminé que la spécificité fonctionnelle réside dans les résidus à la fois à l'intérieur et à côté de l'homéodomaine, et a corroboré les résultats obtenus avec les études Dfd et Ubx.

la protéine chimérique Scr/Antp (Antp de type sauvage avec l'homéodomaine Scr), une protéine Scr fonctionnelle est reconvertie en une protéine Antp fonctionnelle. Par conséquent, la substitution de ces quatre acides aminés à elle seule est suffisante pour déterminer la différence fonctionnelle entre Antp et Scr. Des études similaires impliquant Ubx et Antp, et Dfd et Abd-B ont produit des résultats similaires (Kuziora et McGinnis 1990 Chan et Mann 1993 Zhu et Kuziora 1996). Par conséquent, la spécificité fonctionnelle entre les homéodomaines de deux protéines Ant-C différentes semble être déterminée par seulement quelques acides aminés critiques dans la partie N-terminale de l'homéodomaine, tandis que les résidus dans la grande région N-terminale vers l'homéodomaine ne dirigent que le l'étendue des effets fonctionnels de la protéine.

Comme discuté précédemment, l'état de phosphorylation de deux résidus d'homéodomaine N-terminaux (6 et 7) est critique pour la fonction Scr. En position 6 de l'homéodomaine, Scr a un résidu thréonine, tandis qu'Antp a un résidu glutamine non phosphorylable. L'état de phosphorylation de ce résidu d'homéodomaine N-terminal peut, au moins en partie, expliquer certaines des spécificités fonctionnelles différentes des homéodomaines Scr et Antp.

différences dans la reconnaissance de la séquence d'ADN cible, car les homéodomaines sont inchangés entre les isoformes. Cette incongruité apparente entre la spécificité de la fonction de la protéine Hom-C et le manque apparent de spécificité dans la reconnaissance des cibles d'ADN est souvent appelée le « paradoxe HOX ». Il semble alors probable que la spécificité fonctionnelle résulte de différences spatiales et/ou temporelles d'expression et d'interactions différentielles entre les protéines. La région N-terminale de l'homéodomaine et les régions hautement variables à l'extérieur de la partie conservée de l'homéodomaine peuvent guider les interactions de co-facteurs pour diriger la spécificité de développement provoquée par les gènes sélecteurs homéotiques.

INTERACTIONS COOPÉRATIVES ENTRE LES PROTÉINES HOM-C ET D'AUTRES FACTEURS

Ceci est bien illustré par des études utilisant la protéine Hom-C Dfd et une séquence autorégulatrice connue de Dfd. Des multiples d'un petit fragment de liaison Dfd, dérivé d'un activateur d'autoactivation Dfd, sont suffisants pour entraîner l'expression du rapporteur β-galactosidase dans le segment maxillaire des embryons de drosophile. Cependant, la perte d'une séquence répétée inversée imparfaite supprime l'expression du rapporteur maxillaire (Zeng et al. 1994), suggérant que d'autres protéines doivent également se lier à ce fragment pour permettre l'activation de la transcription. De plus, la protéine Dfd se lie fortement, in vitro, à une répétition en tandem de son site de reconnaissance consensus, mais ne peut activer de manière significative la transcription d'une construction rapporteur contenant ce site que lorsqu'elle est accompagnée du domaine d'activation VP16 constitutif (Li et al. 1999a ). Ainsi, malgré une forte liaison, Dfd seul est insuffisant pour activer le rapporteur sans l'ajout d'une séquence d'activation, indiquant en outre une exigence de facteurs supplémentaires. Enfin, la fusion Dfd-VP16 active l'expression ectopique de Scr, in vivo, alors que la protéine Dfd de type sauvage ne régule pas Scr. Cela démontre que les protéines Hom-C se lient probablement, in vivo, à des sites qui ne se trouvent pas au niveau des promoteurs ou des amplificateurs de gènes cibles normaux.

co-activateurs (Phillips et Luisi 2000). La levure fournit également un exemple d'interaction homéodomaine/doigt de zinc entre les protéines PHO2 et SWI5 lors de la régulation du gène de l'endonucléase HO (Brazas et Stillman 1993 Brazas et al. 1995). Enfin, il existe des protéines contenant des homéodomaines, qui contiennent également des motifs de liaison à l'ADN supplémentaires pour guider leur spécificité de liaison.

Pour que les protéines Hom-C dirigent la spécification des identités de segment, il est évident que des facteurs ou mécanismes supplémentaires sont nécessaires au-delà de la simple liaison d'une protéine Hom-C à un site de reconnaissance. Comment les cofacteurs pourraient-ils contribuer à la sélection des gènes cibles ? Nous mentionnons ci-dessus deux modèles proposés par Biggin et McGinnis (1997) pour le rôle des cofacteurs lors de la régulation de la cible protéique Hom-C. Bien qu'il existe des preuves pour les deux modèles, le modèle Widespread-Binding semble avoir le plus de soutien. Cependant, nous devons souligner qu'il ne s'agira probablement pas d'un processus simple impliquant un, deux ou même trois facteurs. Plus probablement, le processus de sélection du gène cible implique de multiples facteurs, dont certains, comme les produits du gène gap, sont exprimés avant les protéines Hom-C. De plus, en pensant à la fonction de co-facteur, on pourrait s'attendre à une interaction directe avec les protéines Hom-C, mais ce n'est pas nécessairement le cas. Certaines protéines fonctionnant comme co-facteurs peuvent même ne pas être des protéines de liaison à l'ADN, mais pourraient servir de « liens », nécessaires pour stabiliser les interactions entre la machinerie de transcription basale et les protéines Hom-C. De toute évidence, des recherches beaucoup plus approfondies sont nécessaires et, comme il existe des différences entre les différentes espèces d'insectes, une étude comparative peut peut-être apporter des réponses à certaines de ces questions.

Il existe plusieurs caractéristiques génétiques et biochimiques auxquelles nous pouvons nous attendre dans un cofacteur Hom-C :

• L'absence du cofacteur dupliquerait des phénotypes mutants Hom-C complets ou partiels.

• Un cofacteur agirait en parallèle de la protéine Hom-C, ne fonctionnant ni comme un régulateur en amont, ni comme une cible en aval (bien que l'on puisse s'attendre à une certaine « diaphonie » réglementaire entre les deux).

• L'expression du gène cible Hom-C serait réduite ou absente chez les mouches dépourvues du cofacteur.

Plusieurs produits du gène de la drosophile ont été décrits, qui répondent à plusieurs ou à tous ces critères. L'extradenticule du gène codant pour l'homéodomaine (exd) est le cofacteur Hom-C le mieux caractérisé (Peifer et Wieschaus 1990). D'autres gènes proposés pour coder les co-cofacteurs Hom-C incluent le membre de la famille bZip cap'n'collar (cnc), deux gènes codant pour de nouveaux régulateurs de transcription putatifs, des lignées (lin) et apontiques (apt), et le doigt de zinc gènes codant teashirt (tsh), déconnecté (disco), disco-related (disco-r) et peut-être buttonhead (btd).

L'extradenticule (Exd) est un cofacteur de la protéine Hom-C

extradenticle code pour une protéine de 378 acides aminés nécessaire à une bonne structuration embryonnaire et adulte. exd est homologue au groupe pbx de gènes de vertébrés (Rauskolb et al. 1993) et est un membre de la classe PbX hautement conservée des protéines homéodomaines (Bürglin 1994). L'homéodomaine Exd diverge de ceux des gènes Hom-C, ayant trois résidus supplémentaires entre la première et la deuxième hélice alpha. Les homéodomaines atypiques de ce type sont appelés homéodomaines d'extension de boucle à trois acides aminés (TALE). Un deuxième domaine conservé est le domaine PbC-A, à travers lequel Exd interagit avec un deuxième homéodomaine contenant une protéine, Homothorax (Hth) (Ryoo et al. 1999). Cette interaction est discutée en détail ci-dessous.

Les embryons dépourvus de la fonction Exd zygotique meurent à la fin de l'embryogenèse et présentent des défauts dans la formation du motif global (Peifer et Wieschaus 1990). Le développement de certaines structures de la tête est perturbé et les segments thoraciques sont altérés, le deuxième segment thoracique adoptant un premier motif de denticule de type thoracique et le troisième segment thoracique présentant des caractéristiques à la fois du premier segment thoracique et du deuxième segment abdominal. Les identités des segments abdominaux sont transformées en ces deux à trois segments plus postérieurs. Par exemple, le premier segment abdominal ressemble au troisième ou au quatrième. Aucun effet n'est détecté dans les segments les plus postérieurs. Les allèles plus faibles sont des létaux post-embryonnaires formant souvent des adultes pharates avec des défauts de cuticule, et l'analyse clonale démontre que le manque d'Exd provoque également la transformation des structures adultes (Gonzalez-Crespo et Morata 1995 Rauskolb et al. 1995). Les clones exd nuls entraînent une transformation homéotique des structures de la tête, des jambes et des segments abdominaux adultes ressemblant aux phénotypes observés chez certains mutants Hom-C. L'antenne et l'arista se transforment en patte, tandis que la capsule céphalique est modifiée pour ressembler au thorax dorsal ou au notum. Les clones abdominaux des premier à quatrième segments se transforment en cinquième ou six segments abdominaux. La surexpression omniprésente d'exd n'a aucun effet sur les identités de segment (Rauskolb et al. 1995). Étant donné que les mutants exd semblaient avoir des altérations de la spécificité de la cible Hom-C, Peifer et Wieschaus ont proposé exd comme cofacteur Hom-C.

Pour explorer l'interaction et la contribution des protéines Hom-C et Exd au développement, des embryons mutants pour exd ont été comparés à des embryons simplement mutants pour les gènes Hom-C et doublement mutants pour un gène Hom-C et exd. Les doubles mutants différaient de l'un ou l'autre des mutants simples, indiquant que les gènes Hom-C ont continué à être actifs dans leurs domaines normaux en l'absence d'exd, bien qu'ils soient incapables de spécifier correctement l'identité segmentaire (Peifer et Wieschaus 1990). Par exemple, des mutants exd simples présentent une transformation du premier segment abdominal vers le troisième, du deuxième segment abdominal vers le quatrième et du troisième segment abdominal vers le cinquième. Un mutant abd-A présente une transformation de ces mêmes segments en une identité A1. Le mutant double exd abd-A transforme tous ces mêmes segments en une identité A3. Ces résultats indiquent en outre que exd fonctionne dans une voie parallèle aux gènes Hom-C et est requis pour la spécification normale de l'identité de segment par les gènes Hom-C examinés.


Voir la vidéo: Lucas Fanchon - les insectes (Décembre 2021).