Informations

Les enzymes de restriction sont-elles actives à -20 °C ?


J'ai digéré mon ADN avec l'enzyme NotI et je l'ai mis au congélateur à -20 °C sans l'inactiver par la chaleur. Les enzymes de restriction peuvent-elles fonctionner à -20 °C ? Dois-je m'attendre à une activité STAR ?


Les enzymes ont des températures optimales en fonction de l'organisme dont elles ont été isolées. Je prédis donc qu'il n'y a pratiquement pas d'activité à −20 °C. Une autre considération est que les réactions sont susceptibles d'être gelées, ce qui limiterait la diffusion et la ralentirait également. Mais la vraie question est : de quoi as-tu peur ? Juste l'activité vedette ? Même s'il y avait une activité d'étoiles, cela affecterait-il négativement vos expériences ?


Bien qu'il soit peu probable qu'il y ait une activité lorsque l'enzyme est congelée, il existe de meilleures méthodes pour empêcher l'activité des étoiles.

1 : Si vous exécutez la réaction dans une machine PCR, vous pouvez programmer la machine avant la digestion pour qu'elle chauffe jusqu'à 65 degrés pendant 10 minutes après le délai de digestion prévu pour inactiver NotI par la chaleur. Comme NotI est une enzyme thermolabile, cela empêche l'activité des étoiles en la dénaturant.

2: Vous pouvez utiliser NotI-HF, qui a été conçu par NEB pour réduire considérablement la quantité d'activité des étoiles et peut donc être laissé en incubation à 37°C pendant la nuit.

3: Vous pouvez gel purifier ou effectuer une "purification PCR" sur vos échantillons d'ADN digérés, cela supprime également toute protéine présente et empêche donc l'activité des étoiles.


Résumé

On pense que la plupart des endonucléases de restriction de type II interagissent avec l'ADN sous forme d'homodimères. Cfr10I est une enzyme de restriction de type II typique qui reconnaît la séquence 5'-Pu CCGGPy et la clive comme indiqué par la flèche. Les données de filtration sur gel et d'ultracentrifugation analytique présentées ici indiquent que Cfr10I est un homotétramère isolé. Le seul SfiL'enzyme de restriction I qui reconnaît la séquence de reconnaissance longuement interrompue 5'-GGCCNNNNNGGCC a déjà été signalée comme fonctionnant comme un tétramère, mais sa structure est inconnue. Analyse de CfrLes cristaux 10I ont révélé qu'une seule molécule dans l'unité asymétrique est répétée par symétrie D2 pour former un tétramère. Pour déterminer si l'emballage du Cfr10I dans le cristal reflète la structure quaternaire de la protéine en solution, le résidu tryptophane W220 situé à l'interface dimère-dimère putative a été muté en alanine, et les conséquences structurelles et fonctionnelles de la substitution ont été analysées. Des expériences de sédimentation à l'équilibre ont révélé que, contrairement au type sauvage Cfr10I, le mutant W220A existe en solution majoritairement sous forme de dimère. De plus, le tétramère semble être une forme catalytiquement importante de Cfr101, puisque l'activité de clivage de l'ADN du mutant W220A est inférieure à 0,1 % de celle de l'enzyme de type sauvage. De plus, l'analyse du clivage de l'ADN plasmidique suggère que le CfrLe tétramère 10I est capable d'interagir avec deux copies de la séquence de reconnaissance, situées sur la même molécule d'ADN. En effet, des études en microscopie électronique ont démontré que deux sites de reconnaissance distants sont réunis par le bouclage de l'ADN induit par la liaison simultanée du Cfr10I tétramère aux deux sites. Ces données sont cohérentes avec le fait que le tétramère est une forme fonctionnellement importante de Cfr10I.


Tout ce que vous avez toujours voulu savoir sur les enzymes de restriction de type II

A quoi servent les enzymes de restriction de type II ?

Les enzymes de restriction de type II sont celles qui sont familières pour les applications de biologie moléculaire quotidiennes telles que le clonage de gènes et la fragmentation et l'analyse de l'ADN. Ces enzymes clivent l'ADN à des positions fixes par rapport à leur séquence de reconnaissance, créant des fragments reproductibles et des modèles d'électrophorèse sur gel distincts. Plus de 3 500 enzymes de type II ont été découvertes et caractérisées, reconnaissant quelque 350 séquences d'ADN différentes. Des milliers d'autres enzymes de type II ont été identifiées par l'analyse de génomes bactériens et archéens séquencés, mais restent non caractérisées.

Comment les enzymes de restriction de type II sont-elles nommées ?

Les enzymes de restriction sont nommées en fonction du micro-organisme dans lequel elles ont été découvertes. L'enzyme de restriction « HindIII », par exemple, est la troisième de plusieurs activités endonucléases trouvées dans la bactérie Haemophilus influenzae de sérotype d. Le préfixe &lsquoR.&rsquo est parfois ajouté pour distinguer les enzymes de restriction des enzymes de modification avec lesquelles elles s'associent in vivo. Ainsi, &lsquoR.HindIII&rsquo se réfère spécifiquement à l'enzyme de restriction, et &lsquoM.HindIII&rsquo à l'enzyme de modification. Lorsqu'il n'y a pas d'ambiguïté, le préfixe &lsquoR.&rsquo est omis.

Propriétés des enzymes de restriction de type II

Les enzymes de restriction de type II sont très diverses en termes de séquence d'acides aminés, de taille, d'organisation de domaine, de composition de sous-unités, d'exigences en cofacteur et de modes d'action. Ils sont grossièrement classés en une douzaine de sous-types selon leur comportement enzymatique. Il s'agit d'une classification pratique qui reflète leurs propriétés plutôt que leur phylogénie. Il ne reflète pas nécessairement des relations évolutives ou structurelles, et les sous-types ne s'excluent pas mutuellement. Une enzyme peut appartenir à plusieurs sous-types si elle présente chacune des caractéristiques qui la définissent. Nous discutons de ces sous-types dans leur ordre d'importance, les quatre principaux sont les types IIP, IIS, IIC et IIT.


Définition du site actif des enzymes

Le site actif de l'enzyme est le petite région, ce qui semble être un fendu ou cavité composé de près de 10-15 résidus d'acides aminés. Selon le terme, nous pouvons le définir comme un site qui active l'enzyme complexe pour se lier au substrat particulier, induit le substrat’s état de transition et stabiliser le formation du produit. Ainsi, le site actif se réfère simplement au site catalytique. Le site actif exécute deux activités fonctionnelles.

  1. Activité de liaison: L'activité de liaison est une propriété du site actif de l'enzyme, qui augmente la Affinité de liaison du substrat vers une enzyme.
  2. Activité catalytique: C'est une propriété du site actif d'une enzyme, qui aide à la réaction catabolique de l'enzyme et substrat produire produit en réduisant l'énergie d'activation.

Mécanisme de réaction d'une enzyme

Dans une réaction catalysée par une enzyme, le substrat s'attachera au site actif de l'enzyme. Un substrat spécifique se liera au site actif d'une enzyme. En conséquence, un «Complexe enzyme-substrat" formes. Dans le complexe E-S, le substrat sur l'activité enzymatique se convertira en un produit. Enfin, les produits sont libérés et l'enzyme devient libre.

Exemple

Prenons un exemple, où saccharose est un substrat se combinant avec le site actif d'une enzyme "Sucrase”. Après, la liaison du saccharose avec une enzyme sucrase, un Complexe E-S formes. Ensuite, une réaction entre le saccharase et le saccharose a lieu. La réaction changera la conformation structurelle du saccharose appelée "Etat de transition du saccharose”. Le changement de configuration structurelle du saccharose conduit à la conversion du complexe E-S en Complexe E-P. Enfin, glucose et fructose sont libérés sous forme de produits de l'enzyme sucrase.

Points clés

  • Un site actif est un emplacement spécifique trouvé dans l'enzyme où un substrat se lie pour catalyser la réaction. On l'appelle aussi "Surface catalytique enzymatique”.
  • Environ 10 à 15 résidus d'acides aminés se combinent pour former un site actif.

  • Le site actif possède une spécificité forme géométrique et des signaux chimiques qui permettent la reconnaissance et la liaison spécifiques entre une enzyme et un substrat.
  • Un site actif permettra au substrat spécifique de se lier dont la forme complète la forme d'un site actif. Par conséquent, un substrat est comme est un clé qui ne peut s'intégrer que dans le particulier fermer à clé, c'est-à-dire site actif.
  • Le site actif d'une enzyme catalyse de nombreux chimique ou voies biologiques.
  • Après la formation du complexe enzyme-substrat, le substrat et le site actif changent de configuration structurelle en pliant le obligations cibles et casser la molécule de substrat en un produit.
  • Les enzymes présentent une activité catalytique, qui est due à son site actif. Il catalyse un substrat en un produit après liaison complémentaire du substrat avec le site actif d'une enzyme, en fonction de la forme géométrique, de la taille, de la charge et de la stéréospécificité, etc.
  • Le site actif d'une enzyme induit le "Transition du substrat”.

Caractéristiques importantes

Voici les caractéristiques importantes d'un site actif qui comprend :

Hydrophobie

La liaison initiale du substrat et de l'enzyme se produit par la liaison non covalente. Mais, le site catalytique implique interaction hydrophobe dans la fixation d'un substrat avec une enzyme. La liaison hydrophobe du substrat au site actif d'une enzyme augmente la Affinité de liaison. Outre l'interaction hydrophobe, il existe trois autres mécanismes, comme Vander Waal, la liaison hydrogène et la force d'interaction électrostatique, qui favorisent également la formation de complexes E-S.

La flexibilité

Un site actif fait preuve de flexibilité car il peut changer sa conformation pour médier la conversion des substrats en produits.

Réactivité

Le site actif d'une enzyme réagit avec le substrat spécifique. Sa réactivité dépend des conditions environnementales telles que la température, le pH, la concentration d'enzyme et de substrat, etc. Le site actif de l'enzyme se combine avec le substrat et réduit ainsi l'énergie d'activation pour catalyser davantage la réaction.

Charge nette

Le site actif est principalement constitué de non polaire résidus d'acides aminés, qui ne portent aucune charge ou aucune charge nette. Certains sites actifs se composent également de polaire acides aminés, qui portent à la fois des charges positives et négatives. La charge nette du site catalytique décide quel acide aminé se liera à l'enzyme. Il doit y avoir un appariement complémentaire entre le site actif et le substrat. La même charge sur le site catalytique et le substrat ne formera pas un complexe E-S comme répulsion peut résulter entre les deux.

Rôle du site actif

Comme nous l'avons vu, le site actif exécute deux activités principales telles que :

  • La liaison d'un substrat avec une enzyme.
  • L'activité catalytique en convertissant le substrat en produit.

Supposons deux conditions, l'une est la conversion du substrat en un produit sans enzyme et l'autre en présence d'une enzyme.

Première condition

Dans la première condition, nous discuterons de la réaction de transition du substrat en un produit en l'absence d'un catalyseur enzymatique. Pour cela, tracez un graphique entre sens de réaction et énergie. En l'absence d'un « Catalyseur », un substrat (S) nécessitera une valeur supérieure "Énergie d'activation" pour entrer dans l'état de transition, que nous représenterons comme "St”. A l'état de transition, le substrat va changer de conformation et ainsi libérer un produit (P).

Deuxième condition

Ici, nous discuterons de la réaction de transition du substrat en un produit en présence d'un catalyseur enzymatique. Pour cela aussi, tracez un graphique entre sens de réaction et énergie. En présence d'un "Catalyseur", un substrat (S) se liera à un site catalytique enzymatique. L'enzyme est un agent catalytique, qui servira de médiateur catalyse d'un substrat.

L'enzyme va modifier le substrat et l'amener à l'état de transition, que nous représenterons comme "Est”. Dans l'état de transition, l'enzyme et le substrat réagiront, et là un changement se produit dans la configuration du substrat. Ce changement conduira à la formation du complexe produit enzymatique et finalement à la libération d'un produit (P).


3. Méthodes

La méthodologie présentée est adaptée à l'analyse de la structure de la chromatine in vivo et peut aider à la cartographie des interactions ADN-protéine et à élucider leurs implications mécanistiques concernant divers processus nucléaires, y compris la régulation transcriptionnelle, la réparation de l'ADN et la réplication. Les exigences de cette procédure comprennent 1) l'ADN génomique d'intérêt contient des sites de liaison spécifiques à la séquence et répond à des facteurs de transcription spécifiques et 2) a un site de clivage par enzyme de restriction situé à proximité de la région de liaison et est contenu dans les limites d'un nucléosome ou organisé en chromatine.

3.1. Culture de cellules

La procédure expérimentale décrite ci-dessous est basée sur des études dans des cellules de carcinome humain qui ont été transformées de manière stable pour contenir de multiples copies du promoteur MMTV dépendant du récepteur nucléaire. Aux fins de ce protocole, nous avons sélectionné la lignée cellulaire de carcinome surrénalien humain, SW-13, qui n'expriment pas la protéine BRG1 (10). L'utilisation de ces lignées cellulaires de promoteur à copies multiples fournit un très fort rapport signal sur bruit pour la séquence MMTV, ainsi que pour améliorer la capacité à définir la structure de la chromatine du promoteur. L'utilisation de cette lignée cellulaire a considérablement amélioré notre capacité à étudier les cascades initiées par les récepteurs nucléaires qui conduisent à des changements structurels au sein de la chromatine lors de la liaison du récepteur à des éléments de réponse hormonale spécifiques au sein des promoteurs cibles (16, 17). Par conséquent, ces conditions générales de croissance ont été optimisées pour notre lignée cellulaire établie SW-13/MMTV. Les exigences de croissance spécifiques peuvent différer de cette description en fonction du type de cellule utilisé.

3.2. Isolement des noyaux

Ce protocole décrira la procédure standard pour l'isolement des noyaux à partir de cellules en culture tissulaire. Toutes les étapes sont effectuées sur de la glace avec des équipements et des solutions pré-réfrigérés à 4ଌ. Les cellules ont été traitées avec une hormone ou un véhicule avant l'isolement des noyaux pour stimuler la signalisation du récepteur des glucocorticoïdes.

Traiter les cellules avec 100 nM Dex ou un véhicule pendant 1 h avant l'isolement des noyaux.

Rincer les cellules avec du PBS froid et détacher des plaques de 150 mm en grattant les cellules dans 10 ml de PBS froid. Transférer les cellules dans un tube à centrifuger conique de 15 ml pré-refroidi.

Pellet cellules par centrifugation à 500 × g pendant 5 min à 4ଌ. Retirer le PBS du culot cellulaire.

Ajouter du tampon d'homogénéisation froid (5 ml) et déloger doucement le culot cellulaire par pipetage. Transférer les cellules et le tampon dans un broyeur/homogénéisateur de tissus Dounce de 7 ml pré-refroidi et incuber sur de la glace pendant 2 min.

Lyser les cellules en utilisant doucement quatre coups complets du pilon Dounce (pilon serré). Transférer le lysat dans un tube conique de 15 ml pré-refroidi. (voir Remarque 7)

Ajouter délicatement 1 ml de tampon de saccharose directement au fond du tube à l'aide d'une micropipette.

Noyaux de sédimentation à travers un tampon de saccharose par centrifugation à 1400 × g pendant 20 min à 4ଌ. Retirer délicatement le surnageant du culot de noyaux.

Ajouter 1 ml de tampon de lavage aux noyaux et remettre doucement en suspension le culot à l'aide d'une micropipette. Une fois complètement en solution, ajoutez un tampon de lavage supplémentaire de 4 ml et centrifugez à 750 × g pendant 5 min à 4ଌ.

Retirez soigneusement toutes les traces de tampon de lavage et conservez les noyaux sur de la glace.

3.3. In vivo Digestion par endonucléase de restriction

Le choix de l'endonucléase de restriction à utiliser pour ce test d'accessibilité dépend de la disponibilité des sites de clivage dans la région génomique d'intérêt. La plupart des analyses nécessiteront le test de nombreuses enzymes de restriction qui se clivent dans la séquence cible jusqu'à ce qu'une ou plusieurs enzymes optimales soient identifiées. Le tampon de clivage sélectionné pour ce test a été choisi car il maintient l'intégrité structurelle des noyaux et est compatible avec une large gamme d'enzymes de restriction (voir Remarque 8). La quantité d'enzyme à utiliser doit être dérivée de manière empirique et dépendra de l'efficacité avec laquelle l'enzyme clive l'ADN lors de l'utilisation du tampon recommandé pour les tests d'hypersensibilité.

Remettre en suspension délicatement les noyaux dans un tampon de digestion par enzyme de restriction froid (utiliser une ration de tampon de 3:1 pour le culot de noyaux, c'est-à-dire remettre en suspension un culot de noyaux compacts de 50 μl dans un tampon de 150 μl). Transférer des aliquotes de 100 noyaux μl dans des tubes en polypropylène pré-réfrigérés de 5 ml (Falcon 2063).

Digérer les noyaux avec l'endonucléase de restriction appropriée (100-1000U/ml) à 30ଌ pendant 15 min (in vivo digérer). Utilisez 100 noyaux remis en suspension pour chaque digestion.

Arrêtez les réactions en ajoutant 1 ml de tampon protéinase K. Mélanger chaque échantillon en inversant cinq fois et incuber toute la nuit à 37ଌ.

Purifier l'ADN total par quatre extractions avec du phénol/chloroforme/alcool isoamylique (PCI-25:24:1, v/v) et deux extractions avec du chloroforme. Les deux premières extractions doivent être effectuées avec deux fois le volume PCI (2,0 ml) et chaque extraction suivante avec un volume (1,0 ml). Mélanger les échantillons par agitation vigoureuse et centrifuger à 10 000 &# x000d7 g pendant 5 min à température ambiante.

Précipiter l'ADN par addition de 1/10 ème de volume de 1 m de NaCl et 3 volumes d'éthanol à 95 % glacé. Incuber les échantillons à �ଌ pendant 1 h puis sédimenter l'ADN par centrifugation à 12 000 × g pendant 30 min à 4ଌ.

Laver le culot d'ADN avec 1 ml d'éthanol froid à 70 % (v/v) et centrifuger à 12 000 g pendant 10 min à 4 ° C.

Laisser le culot d'ADN sécher à l'air pendant 1 h à température ambiante, remettre en suspension dans 100 &# x003bcl d'eau stérile et transférer dans un tube de microcentrifugeuse de 1,5 ml. (voir Remarque 9).

3.4. In vitro Re-digestion et purification de l'ADN

Le purifié in vivo l'ADN génomique digéré est coupé jusqu'à l'achèvement avec une seconde endonucléase de restriction qui reconnaît un site de clivage en amont ou en aval du in vivo site de l'enzyme de restriction en fonction du brin matrice à étendre. Cette in vitro la digestion est effectuée pendant la nuit généralement avec 100 U d'endonucléase pour assurer une digestion complète de la séquence cible. Les in vitro le digest sert de contrôle interne pour s'assurer que des quantités égales de matrice d'ADN ont été utilisées dans la réaction d'extension d'amorce réitérative.

Digérer l'ADN jusqu'à la fin avec une deuxième enzyme de restriction reconnaissant un site en amont du in vivo site de l'enzyme de restriction. Utilisez 100 unités d'enzyme avec le tampon fourni par le fabricant conformément aux instructions du fabricant (in vitro digérer). Incuber la réaction pendant la nuit à 37ଌ. (voir Remarque 10)

Purifier l'ADN digéré par deux extractions avec du phénol/chloroforme/alcool isoamylique (PCI-25:24:1, v/v) et une extraction avec du chloroforme. Mélanger les échantillons par agitation vigoureuse et centrifuger à grande vitesse (20 800 &# x000d7 g) pendant 5 min à température ambiante.

Précipiter l'ADN par addition de 625 μl glacé à 95 % d'éthanol et de 5 μl 5 M NaCl. Incuber les échantillons à �ଌ pendant 30 min et sédimenter l'ADN par centrifugeuse à grande vitesse (20 800 × g) pendant 30 min à 4ଌ.

Laisser le culot d'ADN sécher à l'air pendant 1 h à température ambiante, remettre en suspension dans 100 &# x003bcl d'eau stérile et déterminer la concentration d'ADN par la lecture de l'absorbance A260/280.

3.5. Marquage final des oligonucléotides spécifiques à la séquence

Le marquage final est une méthode rapide et sensible pour le marquage radioactif de fragments d'ADN tels que les oligonucléotides et est utile pour visualiser de petites quantités d'ADN. Toutes les enzymes employées sont spécifiques des extrémités 3&# ou 5߰ de l'ADN et n'incorporeront, par conséquent, qu'un seul radiophosphate par oligonucléotide. La méthode la plus courante de radiomarquage des oligonucléotides utilise la polynucléotide kinase (PNK) pour transférer un seul groupe phosphate radioactif de γ-32P-ATP à l'extrémité 5′ de l'oligonucléotide.

Dans un tube de microcentrifugeuse de 1,5 ml, ajoutez ce qui suit dans l'ordre indiqué, combinez de l'eau de qualité PCR pour un volume total de 20 μl, 2 μl 10X T4 polynucléotide kinase tampon (fourni avec l'enzyme), 2 μl cible- oligonucléotide spécifique (5 μM), 50 㯌i ATP, [γ-32P]-6000 Ci/mmol, et 20U T4 polynucléotide kinase.

Mélanger la réaction au vortex et centrifuger brièvement.

Incuber le mélange réactionnel pendant 10 min à 37ଌ.

Préparez les colonnes MicroSpin G-25 conformément aux directives du fabricant.

Passer la réaction d'étiquetage sur la colonne G-25 préparée comme indiqué par le protocole du fabricant.

Déterminer l'incorporation de radiomarqueur (cpm/μl) par mesure de compteur à scintillation liquide.

3.6. Extension d'amorce réitérative

L'étendue de l'hypersensibilité aux endonucléases de restriction pour une séquence cible donnée est déterminée en utilisant une extension d'amorce réitérative avec Taq polymérase et un oligonucléotide marqué au 32P spécifique de la matrice. L'amorce sélectionnée pour détecter les régions d'hypersensibilité aux endonucléases de restriction doit être située en amont ou en aval du site de liaison du facteur de transcription, idéalement à 200-300 pb du in vivo site de clivage.

La concentration de Mg et d'oligonucléotide sélectionnés, pour l'extension d'amorce, influence grandement la spécificité et le rendement de la réaction. Par conséquent, les quantités des deux doivent être titrées pour obtenir des résultats optimaux. L'amorce sélectionnée doit s'hybrider en aval du site de clivage de l'endonucléase de restriction in vivo et avoir une longueur supérieure à 18 bases avec des températures de fusion comprises entre 45 et 70 °C. La réaction d'extension d'amorce/PCR réitérative, décrite ci-dessus, a été optimisée pour des études impliquant le promoteur MMTV (10). Ces conditions peuvent être utilisées pour d'autres promoteurs sensibles aux stéroïdes bien qu'une optimisation doive être effectuée. (voir Remarque 11)

Amplifier 10-20 μg purifié in vivo/in vitro ADN génomique digéré dans un mélange réactionnel PCR 30 μl en utilisant 1-5 × 10 6 cpm d'oligonucléotide spécifique de séquence marqué au 32P. (voir Remarque 12)

Le programme du thermocycleur doit inclure un cycle initial de dénaturation à 94 & 000b0C pendant 4 min, un annelage à 60 & 000b0C pendant 2 min et une extension d'amorce à 72 & 000b0C pendant 2 min. Suivez le cycle initial avec 29 cycles de 2 min de dénaturation à 94 & x000b0C, 2 min d'annelage à 60 & # x000b0C et 2 min d'extension d'amorce à 72 & # x000b0C avec extension finale pendant 10 min.

Arrêtez chaque réaction PCR avec l'ajout de 150 μl de tampon d'arrêt PCR.

Purifier les produits étendus par extraction avec deux tours de phénol/chloroforme/alcool isoamylique (500 μl) et un tour de chloroforme (500 μl). Mélanger les échantillons au vortex pendant 5 secondes et centrifuger à grande vitesse (20 800 &# x000d7 g) pendant 5 min à température ambiante.

Précipiter les produits d'extension par addition de 625 μl d'éthanol à 95 % froid et de 5 μl 5 M de NaCl suivi d'une centrifugation à grande vitesse (20 800 × g) pendant 30 min à 4ଌ. Les produits précipités ont été lavés avec de l'éthanol froid à 70 %, récupérés par centrifugation (20 800 × g) pendant 10 min à 4ଌ et laissés sécher à l'air.

3.7. Analyse des produits d'extension de polymérase

Les produits d'extension d'amorce sont résolus sur des gels de polyacrylamide dénaturants. Les échantillons doivent être soumis à une électrophorèse pour obtenir une séparation maximale entre les bandes correspondant à la in vivo site de clivage de l'endonucléase de restriction et le in vitro site de clivage terminal d'extension. Aux fins de cette procédure, les échantillons ont été résolus sur 38 gels de 30 cm à l'aide du système de séquençage des acides nucléiques Sequi-Gen GT (voir Remarque 13).

1- Remettre en suspension les pastilles d'ADN dans un tampon de chargement d'échantillon de 7 μl, vortexer à grande vitesse pendant 10 secondes, centrifuger brièvement, chauffer pendant 5 minutes à 95ଌ, vortexer à nouveau et centrifuger à nouveau pour collecter l'échantillon.

2- Verser le gel de polyacrylamide dénaturant et pré-exécuter selon les spécifications du fabricant.

6- Charger les produits d'extension d'amorce et séparer sur gel de polyacrylamide dénaturant.

7- Après électrophorèse, laisser refroidir le gel puis transférer sur papier filtre.

8- Gel sec sous vide pendant 1 h à 80ଌ.

9- Exposer à l'écran PhosphorImager, numériser et analyser en poursuivant le logiciel ImageQuant (voir Remarque 14).


Introduction

Les endonucléases de restriction (REases) de type IIM et de type IV ne clivent que l'ADN modifié et sont inactives sur l'ADN non modifié 1 . Ils ont évolué dans la course aux armements entre les bactéries et les bactériophages en restreignant les phages avec des bases modifiées dans leurs génomes (examiné dans la référence 2). Type IIM REases tels que DpnI (G m6 ATC) 3 , BisI (G m5 CNgC) 4 , GlaI (R m5 CgY) 5 et MspJI (m5 CNNR 9/13) 6 clivent des sites modifiés à l'intérieur ou à proximité de leurs séquences de reconnaissance à des positions définies 7 . En revanche, les REases de type IV clivent des sites modifiés de manière aléatoire et souvent à une grande distance de leurs séquences de reconnaissance (par exemple EcoK_McrBC (R m5 C N(40–3000) R m5 C) 8 , SauUSI (S m5 CNgS) 9, ScoA3McrA (sites phosphorothioés) 7,10. Les REases de type IIM et IV sont des outils utiles pour analyser les sites m5 modifiés par C dans les ADN de mammifères, car l'hyperméthylation des sites CpG peut altérer l'expression des gènes (par exemple dans la référence 11). GlaI a été utilisé pour digérer l'ADN génomique du cancer hyperméthylé (ADNg) et après la ligature des adaptateurs aux fragments digérés, la région marqueur du cancer peut être sélectivement amplifiée et séquencée 11 . GlaI a également été utilisé dans un test d'activité en temps réel pour l'ADN méthyltransférase humaine (MTase) DNMT1 12 . Les REases dépendantes de la méthylation (MDRE) McrBC et FspEI (C m5 C) peuvent être utilisées dans des applications qPCR ou PCR numériques pour surveiller les changements dans les marqueurs épigénétiques des échantillons d'ADN cliniques 13 . DpnI est utilisé pour détruire le modèle de type sauvage (WT) après PCR, réduisant ainsi le bruit de fond dans les expériences de mutagenèse dirigée par PCR (sites ATC G m6 dans le modèle méthylé par le E. coli Dam méthylase). MspJI-seq (séquençage NGS d'une bibliothèque clivée par MspJI) a été utilisé pour cartographier des sites modifiés dans le Arabidopsis génome 14 . Alors que la plupart des REases dépendantes de la méthylation peuvent couper à la fois l'ADN modifié par m5 C et hm5 C, des REases telles que PvuRts1I qui préfèrent cliver l'ADN modifié par hm5 C se trouvent également dans Nature 15,16. Eco94GmrSD, cependant, préfère cliver hm5 C-modifié et glucosylé hm5 C T4 DNA GmrSD digère mal l'ADN contenant m5 C et l'ADN non modifié 17,18.

BisI a d'abord été découvert et purifié à partir d'une source bactérienne Bacillus subtilis T30 et il clive les sites GCNGC lorsque deux à quatre résidus m5 C modifiés sont présents dans sa séquence de reconnaissance 4,19. Les homologues BisI PkrI et GluI, cependant, nécessitent trois à quatre modifié m5 C dans GCNGC pour l'activité enzymatique 20,21. Le rendement enzymatique et la pureté des trois enzymes sont relativement faibles à partir des sources bactériennes natives, ce qui rend leur coût prohibitif pour des applications généralisées dans les applications de diagnostic qPCR et NGS. Des enzymes hautement purifiées sont également une condition préalable à une caractérisation enzymatique plus poussée et à une analyse de structure.

L'objectif de ce travail était de fournir des REases plus dépendantes des modifications pour les applications de biologie moléculaire et de diagnostic. Nous rapportons ici le clonage et l'expression du gène de l'enzyme de restriction BisI dans E. coli. BisI est le prototype d'une nouvelle famille de REases dépendantes de la méthylation puisque BisI ne partage aucune homologie de séquence d'acides aminés (aa) significative avec les autres enzymes de restriction de type IIM connues telles que DpnI, MspJI, McrBC, Mrr, McrA, ScoA3McrA ou familles SauUSI. En utilisant le serveur BlastP du NCBI pour rechercher des séquences génomiques dans GenBank, nous avons identifié plus de 150 homologues BisI dans des génomes bactériens avec 17% à 100% d'identité de séquence aa. Nous avons cloné/exprimé certains de ces gènes dans E. coli et identifié 23 homologues BisI actifs avec divers degrés d'exigence de m5 C dans le clivage du GCNGC modifié ou de ses sites variants. Nous avons trouvé un homologue BisI (Esp638I) avec une spécificité unique G m5 CS SG m5 C, mais également capable de relâcher sa spécificité à RCN ↓ NGY. Nous avons également déterminé que certaines enzymes de la famille BisI clivent des sites hémiméthylés avec deux m5 C dans un brin d'ADN. De plus, nous avons trouvé deux homologues BisI avec des spécificités dégénérées clivant de l'ADN non modifié.


Graphique d'activité/performance NEBuffer avec enzymes de restriction

Le système de tampon d'enzyme de restriction NEB&rsquos rend vos digestions de restriction faciles et pratiques. Nous sommes en mesure de proposer des enzymes de restriction >215 qui coupent dans un seul tampon, CutSmart ®. Cela améliore la facilité d'utilisation, en particulier lors de l'exécution de doubles résumés. En plus d'indiquer les performances de chaque enzyme dans les 4 NEBuffers, le graphique indique également la ligature et le recoupage, l'activité en étoile et si plus d'un site est requis pour le clivage.

Si vous avez besoin d'informations sur la réalisation de digestions par enzymes de restriction, veuillez vous reporter à Optimisation des réactions d'endonucléase de restriction. Vous pouvez également recevoir une assistance supplémentaire en contactant [email protected]

Nous sommes ravis d'annoncer que nous sommes en train de changer tous les tampons de réaction pour qu'ils soient sans BSA. À partir d'avril 2021, NEB remplacera nos tampons de réaction actuels contenant de la BSA (NEBuffer & trade 1.1, 2.1, 3.1 et CutSmart & reg Buffer) par des tampons contenant de l'albumine recombinante (rAlbumin) (NEBuffer r1.1, r2.1, r3.1 et rCutSmart&trade tampon). Nous prévoyons que ce changement peut prendre jusqu'à 6 mois. Nous pensons que s'éloigner des produits contenant des animaux est un pas dans la bonne direction et sommes en mesure d'offrir cette amélioration au même prix. Plus de détails sur www.neb.com/BSA-free.

Pendant cette période de transition, vous pouvez recevoir un produit avec des tampons contenant du BSA ou de la rAlbumine. NEB a rigoureusement testé les deux et n'a constaté aucune différence dans les performances enzymatiques lors de l'utilisation de l'un ou l'autre des tampons. L'un ou l'autre tampon peut être utilisé avec votre enzyme. Tout le contenu du site Web sera modifié en avril pour refléter les changements, bien que vous ne receviez peut-être pas immédiatement le nouveau tampon avec votre produit.

Légende

Non sensible avec facultés affaiblies
Bloqué Altéré par le chevauchement
Bloqué par chevauchement Altéré par certaines combinaisons de chevauchement
Bloqué par certaines combinaisons de chevauchement
Enzyme Séquence NEBuffer fourni % Activité dans NEBuffer Chaleur Inac. Incu. Temp. Diluant Endiguer Dcm CpG Substrat unitaire Remarques
r1.1 r2.1 r3.1 rCutSmart
AatII GACGT/C Tampon rCutSmart™ 80°C 37°C B ADN
AbaSI CNNNNNNNNNNN/NNNNNNNNNG Tampon rCutSmart™ 25 50 50 100 65°C 25°C C ADN de phage de type sauvage T4 (entièrement modifié par ghmC) e
AccI GT/MKAC Tampon rCutSmart™ 50 50 10 100 80°C 37°C UNE ADN
Acc65I G/GTACC NEBuffer&trade r3.1 10 75* 100 25 65°C 37°C UNE ADN pBC4
AciI CCGC(-3/-1) Tampon rCutSmart™ ADN
AclI AA/CGTT Tampon rCutSmart™ ADN
AcuI CTGAAG (16/14) Tampon rCutSmart™ 50 100 50 100 65°C 37°C B ADN 1, b, d
AfeI AGC/GCT Tampon rCutSmart™ 25 100 25 100 65°C 37°C B ADN pXba
AflII C/TTAAG Tampon rCutSmart™ 50 100 10 100 65°C 37°C UNE X174 RF I ADN
AflIII A/CRYGT NEBuffer&trade r3.1 10 50 100 50 80°C 37°C B ADN
ÂgeI § A/CCGGT NEBuffer&trade r1.1 100 75 25 75 65°C 37°C C ADN
AgeI-HF® A/CCGGT Tampon rCutSmart™ 100 50 10 100 65°C 37°C UNE ADN
AhdI GACNNN/NNGTC Tampon rCutSmart™ 25 25 10 100 65°C 37°C UNE ADN une
AleI-v2 CACNN/NNTGG Tampon rCutSmart™
AluI AG/CT Tampon rCutSmart™ 25 100 50 100 80°C 37°C B ADN b
AlwI GGATC(4/5) Tampon rCutSmart™ 50 50 10 100 Non 37°C UNE ADN (dam-) 1, b, d
AlwNI CAGNNN/CTG Tampon rCutSmart™ 10 100 50 100 80°C 37°C UNE ADN
Apai GGGCC/C Tampon rCutSmart™ 25 25 ADN pXba
ApALI G/TGCAC Tampon rCutSmart™ 100 100 10 100 Non 37°C UNE ADN (digeste HindIII)
ApeKI G/CWGC NEBuffer&trade r3.1 25 50 100 10 Non 75°C B ADN
ApoI § R/AATTY NEBuffer&trade r3.1 10 75 100 75 80°C 50°C UNE ADN
ApoI-HF R/AATTY Tampon rCutSmart™ 10 100 10 100 80°C 37°C B ADN
AscI GG/CGCGCC Tampon rCutSmart™ 80°C 37°C UNE ADN
AseI AT/TAAT NEBuffer&trade r3.1 ADN 3
AsiSI GCGAT/CGC Tampon rCutSmart™ 100 100 25 100 80°C 37°C B pXba digéré par XhoI 2, b
AvaI C/YCGRG Tampon rCutSmart™ 80°C 37°C UNE ADN
AvaII G/GWCC Tampon rCutSmart™ 50 75 10 100 80°C 37°C UNE ADN
AvrII C/CTAGG Tampon rCutSmart™ 100 50 50 100 Non 37°C B ADN (digeste HindIII)
BaeGI GKGCM/C NEBuffer&trade r3.1 75 75 100 25 80°C 37°C UNE ADN
BaeI (10/15)ACNNNNGTAYC(12/7) Tampon rCutSmart™ + SAM 50 100 50 100 65°C 25°C UNE ADN e
BamHI § G/GATCC NEBuffer&trade r3.1 75* 100* 100 100* Non 37°C UNE ADN 3
BamHI-HF® G/GATCC Tampon rCutSmart™ 100 50 10 100 Non 37°C UNE ADN
BanI G/GYRCC Tampon rCutSmart™ 10 25 ADN 1
BanII GRGCY/C Tampon rCutSmart™ 100 100 50 100 80°C 37°C UNE ADN 2
BbsI § GAAGAC(2/6) NEBuffer&trade r2.1 100 100 25 75 65°C 37°C B ADN
BbsI-HF ® GAAGAC(2/6) Tampon rCutSmart™ 10 10 10 100 65°C 37°C B ADN
BbvCI CCTCAGC(-5/-2) Tampon rCutSmart™ 10 100 50 100 Non 37°C B ADN 1, un
BbvI GCAGC (8/12) Tampon rCutSmart™ 100 100 25 100 65°C 37°C B ADN pBR322 3
BccI CCCAT(4/5) Tampon rCutSmart™ 100 50 10 100 65°C 37°C UNE ADN pXba 3, b
BceAI ACGGC(12/14) NEBuffer&trade r3.1 100* 100* 100 100* 65°C 37°C UNE ADN pBR322 1
BcgI (10/12)CGANNNNNNTGC(12/10) NEBuffer&trade r3.1 10 75* 100 50* 65°C 37°C UNE ADN e
BciVI GTATCC (6/5) Tampon rCutSmart™ 100 25 80°C 37°C C ADN b
BclI § T/GATCA NEBuffer&trade r3.1 50 100 100 75 Non 50°C UNE ADN (dam-)
BclI-HF T/GATCA Tampon rCutSmart™ 100 100 10 100 65°C 37°C B ADN (dam-)
BcoDI CGV(1/5) Tampon rCutSmart™ 50 75 75 100 Non 37°C B ADN
BfaI C/ÉTIQUETTE Tampon rCutSmart™ 80°C 37°C B ADN 2, b
BfuAI ACCTGC(4/8) NEBuffer&trade r3.1 ADN 3
BglI GCCNNNN/NGGC NEBuffer&trade r3.1 10 25 100 10 65°C 37°C B ADN
BglII A/AGCT NEBuffer&trade r3.1 10 10 100 ADN
BlpI GC/TNAGC Tampon rCutSmart™ 50 100 10 100 Non 37°C UNE ADN
BmgBI CACGTC(-3/-3) NEBuffer&trade r3.1 ADN 3, b, d
BmrI ACTGGG(5/4) NEBuffer&trade r2.1 75 100 75 100* 65°C 37°C B ADN (digeste HindIII) b
BmtI § GCTAG/C NEBuffer&trade r3.1 100 100 100 100 + 65°C 37°C B ADN pXba 2
BmtI-HF® GCTAG/C Tampon rCutSmart™ 50 100 10 100 65°C 37°C B ADN pXba
BpmI CTGGAG (16/14) NEBuffer&trade r3.1 75 100 100 100* 65°C 37°C B ADN 2
BpuEI CTTGAG (16/14) Tampon rCutSmart™ 50* 100 50* 100 65°C 37°C B ADN
Bpu10I CCTNAGC(-5/-2) NEBuffer&trade r3.1 10 25 100 25 80°C 37°C B ADN 3, b, d
BsaAI YAC/GTR Tampon rCutSmart™ 100 100 100 100 Non 37°C C ADN
BsaBI GATNN/NNATC Tampon rCutSmart™ 50 100 75 100 80°C 60°C B ADN (dam-) 2
BsaHI GR/CGYC Tampon rCutSmart™ 50 100 100 100 80°C 37°C C ADN
Bsal-HF®v2 GGTCTC(1/5) Tampon rCutSmart™ 100 100 100 100 80°C 37°C B ADN pXba
BsaJI C/CNNGG Tampon rCutSmart™ 50 100 100 100 80°C 60°C UNE ADN
BsaWI Avec CCGGW Tampon rCutSmart™ 10 100 50 100 80°C 60°C UNE ADN
BsaXI (9/12)ACNNNNNCTCC(10/7) Tampon rCutSmart™ 50* 100* 10 100 Non 37°C C ADN e
BseRI GAGGAG(10/8) Tampon rCutSmart™ 100 100 75 100 80°C 37°C UNE ADN
BseYI CCCACG(-5/-1) NEBuffer&trade r3.1 10 50 100 50 80°C 37°C B ADN
BsgI GTGCAG (16/14) Tampon rCutSmart™ 25 50 25 100 65°C 37°C B ADN
BsiEI CGRY/CG Tampon rCutSmart™ 25 50 ADN
BsiHKAI GWGCW/C Tampon rCutSmart™ 25 100 100 100 Non 65°C UNE ADN
BsiWI § C/GTACG NEBuffer&trade r3.1 25 50* 100 25 65°C 55°C B DNAX174 ADN
BsiWI-HF ® C/GTACG Tampon rCutSmart™ 50 100 10 100 Non 37°C B DNAX174 ADN
BslI CCNNNNN/NNGG Tampon rCutSmart™ 50 75 100 100 Non 55°C UNE ADN b
BsmAI CGV(1/5) Tampon rCutSmart™ 50 100 100 100 Non 55°C B ADN
BsmBI-v2 CGTCTC NEBuffer&trade r3.1 80°C 55°C B
BsmFI GGGAC (10/14) Tampon rCutSmart™ 25 50 50 100 80°C 65°C UNE ADN pBR322 1
BsmI GAATGC(1/-1) Tampon rCutSmart™ 25 100 80°C 65°C UNE ADN
BsoBI C/YCGRG Tampon rCutSmart™ 25 100 100 100 80°C 37°C UNE ADN
BspCNI CTCAG(9/7) Tampon rCutSmart™ 100 75 10 100 80°C 37°C UNE ADN b
BspDI AT/CGAT Tampon rCutSmart™ 25 75 50 100 80°C 37°C UNE ADN
BspEI T/CCGGA NEBuffer&trade r3.1 80°C 37°C B ADN (dam-)
BspHI T/CATGA Tampon rCutSmart™ 10 50 25 100 80°C 37°C UNE ADN
Bsp1286I GDGCH/C Tampon rCutSmart™ 25 25 25 100 65°C 37°C UNE ADN 3
BspMI ACCTGC(4/8) NEBuffer&trade r3.1 10 50* 100 10 65°C 37°C B ADN
BspQI GCTCTTC(1/4) NEBuffer&trade r3.1 100* 100* 100 100* 80°C 50°C B ADN 3
BsrBI CCGCTC(-3/-3) Tampon rCutSmart™ 50 100 100 100 80°C 37°C UNE ADN
BsrDI GCAATG(2/0) NEBuffer&trade r2.1 10 100 75 25 80°C 65°C UNE ADN 3, d
BsrFI-v2 R/CCGGY Tampon rCutSmart™ 25 25 0 100 Non 37°C C ADN pBR322
BsrGI § T/GTACA NEBuffer&trade r2.1 25 100 100 25 80°C 37°C UNE ADN
BsrGI-HF® T/GTACA Tampon rCutSmart™ 10 100 100 100 80°C 37°C UNE ADN
BsrI ACTGG(1/-1) NEBuffer&trade r3.1 80°C 65°C B DNAX174 ADN b
BssHII G/CGCGC Tampon rCutSmart™ 100 100 100 100 65°C 50°C B ADN
BssSI-v2 CACGAG(-5/-1) Tampon rCutSmart™ 10 25 ADN
BstAPI GCANNNN/NTGC Tampon rCutSmart™ 50 100 25 100 80°C 60°C UNE ADN b
BstBI TT/CGAA Tampon rCutSmart™ 75 100 10 100 Non 65°C UNE ADN
BstEII § G/GTNACC NEBuffer&trade r3.1 10 75* 100 75* Non 60°C UNE ADN 3
BstEII-HF® G/GTNACC Tampon rCutSmart™ ADN
BstNI CC/WGG NEBuffer&trade r3.1 10 100 100 75 Non 60°C UNE ADN une
BstUI CG/CG Tampon rCutSmart™ 50 100 25 100 Non 60°C UNE ADN b
BstXI CCANNNNN/NTGG NEBuffer&trade r3.1 80°C 37°C B ADN 3
BstYI R/GACY NEBuffer&trade r2.1 25 100 75 100 Non 60°C UNE ADN
BstZ17I-HF ® GTATAC Tampon rCutSmart™ 100 100 10 100 Non 37°C UNE ADN
Bsu36I CC/TNAGG Tampon rCutSmart™ 25 100 100 100 80°C 37°C C ADN (digeste HindIII) b
BtgI C/CRYGG Tampon rCutSmart™ 50 100 100 100 80°C 37°C B ADN pBR322
BtgZI GCGATG (10/14) Tampon rCutSmart™ 10 25 80°C 60°C UNE ADN 3, b, d
BtsCI GGATG(2/0) Tampon rCutSmart™ 10 100 25 100 80°C 50°C B ADN
BtsIMutI CAGTG(2/0) Tampon rCutSmart™ 100 50 10 100 80°C 55°C UNE ADN pUC19 b
BtsI-v2 GCAGTG(2/0) Tampon rCutSmart™ 100 100 25 100 Non 37°C UNE ADN 1
Cac8I GCN/NGC Tampon rCutSmart™ 50 75 100 100 65°C 37°C B ADN b
ClaI AT/CGAT Tampon rCutSmart™ 10 50 50 100 65°C 37°C UNE ADN (dam-)
CspCI (11/13)CAANNNNNGTGG(12/10) Tampon rCutSmart™ 10 100 10 100 65°C 37°C UNE ADN e
CviAII C/ATG Tampon rCutSmart™ 50 50 10 100 65°C 25°C C ADN
CviKI-1 RG/CY Tampon rCutSmart™ 25 100 100 100 Non 37°C UNE ADN pBR322 1, b
CviQI G/TAC NEBuffer&trade r3.1 75 100* 100 75* Non 25°C C ADN b
DdeI C/TNAG Tampon rCutSmart™ 75 100 100 100 65°C 37°C B ADN
DpnI AG/TC Tampon rCutSmart™ 100 100 75 100 80°C 37°C B ADN pBR322 (dam méthylé) b
DpnII /GATC NEBuffer&trade DpnII 25 25 100* 25 65°C 37°C B ADN (dam-)
DraI TTT/AAA Tampon rCutSmart™ 75 75 50 100 65°C 37°C UNE ADN
DraIII-HF® CACNNN/GTG Tampon rCutSmart™ ADN b
DrdI GACNNNN/NNGTC Tampon rCutSmart™ 25 50 10 100 65°C 37°C UNE ADN pUC19 3
EaI Y/GGCCR Tampon rCutSmart™ 10 50 ADN b
EagI-HF® C/GGCCG Tampon rCutSmart™ 25 100 100 100 65°C 37°C B ADN pXba
oreilleI CTCTTC(1/4) Tampon rCutSmart™ 50 10 ADN b, d
EciI GGCGGA(11/9) Tampon rCutSmart™ 100 50 50 100 65°C 37°C UNE ADN 2
Eco53kI BAG/CTC Tampon rCutSmart™ 100 100 ADN pXba 3, b
EcoNI CCTNN/NNNAGG Tampon rCutSmart™ 50 100 75 100 65°C 37°C UNE ADN b
EcoO109I RG/GNCCY Tampon rCutSmart™ 50 100 50 100 65°C 37°C UNE ADN (digeste HindIII) 3
EcoP15I CAGCAG (25/27) NEBuffer&trade r3.1 + ATP 75 100 100 100 65°C 37°C UNE ADN pUC19 e
EcoRI § G/AATTC NEBuffer™ EcoRI/SspI 25 100* 50 50* 65°C 37°C C ADN
EcoRI-HF® G/AATTC Tampon rCutSmart™ 10 100 ADN
EcoRV § CAG/ATC NEBuffer&trade r3.1 10 50 100 10 80°C 37°C UNE ADN
EcoRV-HF® CAG/ATC Tampon rCutSmart™ 25 100 100 100 65°C 37°C B ADN
Esp3I CGTCTC(1/5) Tampon rCutSmart™ 100 100 ADN
FatI /CATG NEBuffer&trade r2.1 10 100 50 50 80°C 55°C UNE ADN pUC19
FauI CCCGC(4/6) Tampon rCutSmart™ 100 50 10 100 65°C 55°C UNE ADN 3, b, d
Fnu4HI GC/NGC Tampon rCutSmart™ ADN une
FokI GGATG(9/13) Tampon rCutSmart™ 100 100 75 100 65°C 37°C UNE ADN 3, b, d
FseI GGCCGG/CC Tampon rCutSmart™ 100 75 ADN pBC4
FspEI CC(12/16) Tampon rCutSmart™ 80°C 37°C B ADN de pBR322 (dcm+) 1, e
FspI TGC/GCA Tampon rCutSmart™ 10 100 10 100 Non 37°C C ADN b
HaeII RGCGC/Y Tampon rCutSmart™ 25 100 10 100 80°C 37°C UNE ADN
HaeIII GG/CC Tampon rCutSmart™ 50 100 25 100 80°C 37°C UNE ADN
HgaI GACGC (5/10) NEBuffer&trade r1.1 100 100 25 100* 65°C 37°C UNE DNAX174 ADN 1
HhaI GCG/C Tampon rCutSmart™ 25 100 100 100 65°C 37°C UNE ADN
HincII GTY/RAC NEBuffer&trade r3.1 25 100 100 100 65°C 37°C B ADN
HindIII § A/AGCTT NEBuffer&trade r2.1 25 100 50 50 80°C 37°C B ADN 2
HindIII-HF® A/AGCTT Tampon rCutSmart™ 10 100 10 100 80°C 37°C B ADN
HinfI G/ANTC Tampon rCutSmart™ 50 100 100 100 80°C 37°C UNE ADN
HinP1I G/CGC Tampon rCutSmart™ 100 100 100 100 65°C 37°C UNE ADN
HpaI GTT/AAC Tampon rCutSmart™ ADN 1
HpaII C/CGG Tampon rCutSmart™ 100 50 80°C 37°C UNE ADN
HphI GGTGA(8/7) Tampon rCutSmart™ 50 50 ADN 1, b, d
HpyAV CCTTC(6/5) Tampon rCutSmart™ 100 100 25 100 65°C 37°C ADN 3, b, d
HpyCH4III ACN/GT Tampon rCutSmart™ 100 25 ADN b
HpyCH4IV A/CGT Tampon rCutSmart™ 100 50 25 100 65°C 37°C UNE ADN pUC19
HpyCH4V TG/CA Tampon rCutSmart™ 50 50 25 100 65°C 37°C UNE ADN
Hpy188I TCN/GA Tampon rCutSmart™ 25 100 50 100 65°C 37°C UNE ADN pBR322 1, b
Hpy99I CGWCG/ Tampon rCutSmart™ 50 10 ADN
Hpy166II GTN/NAC Tampon rCutSmart™ 100 100 50 100 65°C 37°C C ADN pBR322
Hpy188III TC/NNGA Tampon rCutSmart™ 100 100 10 100 65°C 37°C B ADN pUC19 3, b
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) Tampon rCutSmart™ 10 10 10 100 65°C 37°C B Plasmide de contrôle linéarisé pBHS ScaI
I-SceI TAGGGATAACAGGGTAAT(-9/-13) Tampon rCutSmart™ 10 50 25 100 65°C 37°C B Plasmide de contrôle pGPS2 NotI-linéarisé
KasI G/GCCGCC Tampon rCutSmart™ 50 100 50 100 65°C 37°C B ADN pBR322 3
KpnI § GGTAC/C NEBuffer&trade r1.1 100 75 ADN pXba 1
KpnI-HF® GGTAC/C Tampon rCutSmart™ 100 25 ADN pXba
LpnPI CCDG (10/14) Tampon rCutSmart™ ADN de pBR322 (dcm+) 1, e
MboI /GATC Tampon rCutSmart™ 75 100 100 100 65°C 37°C UNE ADN (dam-)
MboII GAAGA(8/7) Tampon rCutSmart™ 100* 100 50 100 65°C 37°C C ADN (dam-) b
MfeI § C/AATTG Tampon rCutSmart™ 75 50 10 100 Non 37°C UNE ADN 2
MfeI-HF® C/AATTG Tampon rCutSmart™ 75 25 ADN
MluCI /AATT Tampon rCutSmart™ 100 10 10 100 Non 37°C UNE ADN
MluI § A/CGGCT NEBuffer&trade r3.1 10 50 100 25 80°C 37°C UNE ADN
MluI-HF® A/CGGCT Tampon rCutSmart™ 25 100 100 100 Non 37°C UNE ADN
MlyI GAGTC (5/5) Tampon rCutSmart™ 50 50 10 100 65°C 37°C UNE ADN b, d
MmeI TCCRAC (20/18) Tampon rCutSmart™ 50 100 50 100 65°C 37°C B X174 RF I ADN avant JC
MnlI CCTC(7/6) Tampon rCutSmart™ 75 100 50 100 65°C 37°C B ADN b
MscI TGG/CCA Tampon rCutSmart™ 25 100 100 100 80°C 37°C C ADN
MseI T/AAT Tampon rCutSmart™ 75 100 75 100 65°C 37°C UNE ADN
MslI CAYNN/NNRTG Tampon rCutSmart™ 50 50 80°C 37°C UNE ADN
MspA1I CMG/CKG Tampon rCutSmart™ 10 50 10 100 65°C 37°C B ADN
MspI C/CGG Tampon rCutSmart™ 75 100 50 100 Non 37°C UNE ADN
MspJI CNNR(9/13) Tampon rCutSmart™ ADN de pBR322 (dcm+) 1, e
MwoI GCNNNNN/NNGC Tampon rCutSmart™ ADN
NaeI GCC/GGC Tampon rCutSmart™ 25 25 ADN pXba b
NarI GG/CGCC Tampon rCutSmart™ 100 100 10 100 65°C 37°C UNE ADN pXba
Nb.BbvCI CCTCAGC Tampon rCutSmart™ 25 100 100 100 80°C 37°C UNE ADN plasmidique superenroulé e
Nb.BsmI GAATGC NEBuffer&trade r3.1 80°C 65°C UNE ADN du plasmide pBR322 superenroulé e
Nb.BsrDI GCAATG Tampon rCutSmart™ 25 100 100 100 80°C 65°C UNE ADN pUC19 superenroulé e
Nb.BssSI CACGAG NEBuffer&trade r3.1 10 100 100 25 Non 37°C B ADN pUC19 superenroulé e
Nb.BtsI GCAGTG Tampon rCutSmart™ 75 100 75 100 80°C 37°C UNE ADN de pUC101 superenroulé (dam-/dcm-) e
NciI CC/SGG Tampon rCutSmart™ 100 25 10 100 Non 37°C UNE ADN b
NcoI § C/CATGG NEBuffer&trade r3.1 100 100 100 100 + 80°C 37°C UNE ADN
NcoI-HF® C/CATGG Tampon rCutSmart™ 50 100 10 100 80°C 37°C B ADN
NdeI CA/TATG Tampon rCutSmart™ 75 100 100 100 65°C 37°C UNE ADN
NgoMIV G/CCGGC Tampon rCutSmart™ 100 50 10 100 Non 37°C UNE ADN pXba 1
NheI-HF® G/CTAGC Tampon rCutSmart™ 100 25 10 100 80°C 37°C C ADN (digeste HindIII)
NlaIII CATG/ Tampon rCutSmart™ X174 RF I ADN
NlaIV GGN/NCC Tampon rCutSmart™ 10 10 10 100 65°C 37°C B ADN pBR322
NmeAIII GCCGAG(21/19) Tampon rCutSmart™ 10 10 X174 RF I ADN c
NonI § GC/GGCCGC NEBuffer&trade r3.1 ADN pBC4
NotI-HF® GC/GGCCGC Tampon rCutSmart™ 25 100 25 100 65°C 37°C UNE ADN pBC4
NruI § TCG/CGA NEBuffer&trade r3.1 ADN b
NruI-HF® TCG/CGA Tampon rCutSmart™ 0 25 50 100 Non 37°C UNE ADN
NsiI § ATGCA/T NEBuffer&trade r3.1 10 75 100 25 65°C 37°C B ADN
NsiI-HF® ATGCA/T Tampon rCutSmart™ 80°C 37°C B ADN
NspI RCATG/O Tampon rCutSmart™ 100 100 ADN
Nt.AlwI GGATC(4/-5) Tampon rCutSmart™ 10 100 100 100 80°C 37°C UNE ADN pUC101 (dam-/dcm-) e
Nt.BbvCI CCTCAGC(-5/-7) Tampon rCutSmart™ 50 100 10 100 80°C 37°C UNE ADN plasmidique superenroulé e
Nt.BsmAI CGV(1/-5) Tampon rCutSmart™ 100 50 10 100 65°C 37°C UNE ADN plasmidique superenroulé e
Nt.BspQI GCTCTTC(1/-7) NEBuffer&trade r3.1 80°C 50°C B ADN pUC19 superenroulé e
Nt.BstNBI GAGTC(4/-5) NEBuffer&trade r3.1 0 10 100 10 80°C 55°C UNE ADN T7 e
Nt.CviPII (0/-1)CCD Tampon rCutSmart™ 10 100 25 100 65°C 37°C UNE ADN pUC19 e
PacI TTAAT/TAA Tampon rCutSmart™ 100 75 10 100 65°C 37°C UNE ADN pNEB193
PaeR7I C/TCGAG Tampon rCutSmart™ 25 100 10 100 Non 37°C UNE ADN (digeste HindIII)
PaqCI CACCTGC(4/8) Tampon rCutSmart™ 10 100 10 100 65°C 37°C B ADN 1
PCII A/CATGT NEBuffer&trade r3.1 50 75 100 50* 80°C 37°C B ADN pXba
PflFI GACN/NNGTC Tampon rCutSmart™ 25 100 25 100 65°C 37°C UNE ADN pBC4 b
PflMI CCANNNN/NTGG NEBuffer&trade r3.1 0 100 100 50 65°C 37°C UNE ADN 3, b, d
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) NEBuffer&trade PI-PspI + BSA 10 10 10 10 Non 65°C B Plasmide de contrôle pAKR7 XmnI-linéarisé
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) NEBuffer™ PI-SceI + BSA 10 10 10 10 65°C 37°C B Plasmide de contrôle linéarisé pBSvdeX XmnI
PleI GAGTC(4/5) Tampon rCutSmart™ 25 50 25 100 65°C 37°C UNE ADN b, d
PluTI GGCGC/C Tampon rCutSmart™ 100 25 ADN pXba b
PmeI GTTT/AAAC Tampon rCutSmart™ ADN
PmlI CAC/GTG Tampon rCutSmart™ 100 50 ADN (digeste HindIII) ADN
PpuMI RG/GWCCY Tampon rCutSmart™ ADN (digeste HindIII)
PshAI GACNN/NNGTC Tampon rCutSmart™ 25 50 10 100 65°C 37°C UNE ADN
PsiI-v2 TTA/TAA Tampon rCutSmart™ 25 50 10 100 65°C 37°C B ADN 3
PspGI /CCWGG Tampon rCutSmart™ 25 100 50 100 Non 75°C UNE ADN T7 3
PspOMI G/CCGGCC Tampon rCutSmart™ 10 10 ADN pXba
PspXI VC/TCGAGB Tampon rCutSmart™ ADN (digeste HindIII)
PstI § CTGCA/G NEBuffer&trade r3.1 75 75 100 50* 80°C 37°C C ADN
PstI-HF® CTGCA/G Tampon rCutSmart™ 10 75 50 100 Non 37°C C ADN
PvuI § CGAT/CG NEBuffer&trade r3.1 ADN pXba
PvuI-HF® CGAT/CG Tampon rCutSmart™ 25 100 100 100 Non 37°C B ADN pXba
PvuII § CAG/CTG NEBuffer&trade r3.1 50 100 100 100* Non 37°C B ADN
PvuII-HF® CAG/CTG Tampon rCutSmart™ ADN
Rsal GT/AC Tampon rCutSmart™ 25 50 ADN
RsrII CG/GWCCG Tampon rCutSmart™ 25 75 10 100 65°C 37°C C ADN
SacI § GAGCT/C NEBuffer&trade r1.1 100 50 10 100 + 65°C 37°C UNE ADN (digeste HindIII)
SacI-HF® GAGCT/C Tampon rCutSmart™ 10 50 ADN (digeste HindIII)
SacII CCGC/GG Tampon rCutSmart™ 10 100 10 100 65°C 37°C UNE ADN pXba
SalI § G/TCGAC NEBuffer&trade r3.1 ADN (digeste HindIII)
SalI-HF® G/TCGAC Tampon rCutSmart™ 10 100 100 100 65°C 37°C UNE ADN (digeste HindIII)
SapI GCTCTTC(1/4) Tampon rCutSmart™ 75 50 ADN
Sau3AI /GATC NEBuffer&trade r1.1 100 50 10 100 + 65°C 37°C UNE ADN b
Sau96I G/GNCC Tampon rCutSmart™ 50 100 100 100 65°C 37°C UNE ADN
SbfI § CCTGCA/GG Tampon rCutSmart™ 50 25 80°C 37°C UNE ADN 3
SbfI-HF® CCTGCA/GG Tampon rCutSmart™ 50 25 80°C 37°C B ADN
ScaI-HF® AGT/ACT Tampon rCutSmart™ 100 100 10 100 80°C 37°C B ADN
ScrFI CC/NGG Tampon rCutSmart™ 100 100 100 100 65°C 37°C C ADN 2, un
SexeIA A/CCWGGT Tampon rCutSmart™ 100 75 50 100 65°C 37°C UNE ADN de pBC4 (dcm-) 3, b, d
SfaNI GCATC(5/9) NEBuffer&trade r3.1 X174 RF I ADN 3, b
SfcI C/TRYAG Tampon rCutSmart™ 75 50 25 100 65°C 37°C B ADN 3
SfiI GGCCNNNN/NGGCC Tampon rCutSmart™ 25 100 50 100 Non 50°C C ADN pXba
SfoI GGC/GCC Tampon rCutSmart™ 50 100 100 100 Non 37°C B ADN (digeste HindIII)
SgrAI CR/CCGGYG Tampon rCutSmart™ 100 100 10 100 65°C 37°C UNE ADN 1
SmaI CCC/GGG Tampon rCutSmart™ ADN (digeste HindIII) b
SmlI C/TYRAG Tampon rCutSmart™ 25 75 25 100 Non 55°C UNE ADN b
SnaBI TAC/RGT Tampon rCutSmart™ 50* 50 10 100 80°C 37°C UNE ADN T7 1
SpéI § A/CTAGT Tampon rCutSmart™ 75 100 25 100 80°C 37°C C ADN pXba-XbaI
SpeI-HF® A/CTAGT Tampon rCutSmart™ 25 50 10 100 80°C 37°C C ADN pXba-XbaI
SphI § GCATG/C NEBuffer&trade r2.1 100 100 50 100 + 65°C 37°C B ADN 2
SphI-HF® GCATG/C Tampon rCutSmart™ 50 25 10 100 65°C 37°C B ADN
SrfI GCCC/GGGC Tampon rCutSmart™ 10 50 0 100 65°C 37°C B ADN pNEB193-SrfI
SspI § AAT/ATT NEBuffer™ EcoRI/SspI 50 100 50 50 65°C 37°C C ADN
SspI-HF® AAT/ATT Tampon rCutSmart™ 25 100 ADN
StuI AGG/CCT Tampon rCutSmart™ 50 100 50 100 Non 37°C UNE ADN
StyD4I /CCNGG Tampon rCutSmart™ 10 100 100 100 65°C 37°C B ADN
StyI-HF® C/CWWGG Tampon rCutSmart™ 25 100 25 100 65°C 37°C UNE ADN
Swai ATTT/AAAT NEBuffer&trade r3.1 10 10 100 10 65°C 25°C B ADN pXba b, d
TaqI-v2 T/CGA Tampon rCutSmart™ 50 100 50 100 Non 65°C B ADN
TfiI G/AWTC Tampon rCutSmart™ 50 100 100 100 Non 65°C C ADN
TseI G/CWGC Tampon rCutSmart™ 75 100 100 100 Non 65°C B ADN 3
Tsp45I /GTSAC Tampon rCutSmart™ 100 50 ADN
TspMI C/CCGGG Tampon rCutSmart™ 50* 75* 50* 100 Non 75°C B ADN plasmidique pUCAdeno
TspRI NNCASTGNN/ Tampon rCutSmart™ 25 50 25 100 Non 65°C B ADN
Tth111I GACN/NNGTC Tampon rCutSmart™ 25 100 25 100 Non 65°C B ADN pBC4 b
XbaI T/CTAGA Tampon rCutSmart™ ADN (digeste dam-/Hind III)
XcmI CCANNNNN/NNNNTGG NEBuffer&trade r2.1 10 100 25 100* 65°C 37°C C ADN 2
XhoI C/TCGAG Tampon rCutSmart™ 75 100 100 100 65°C 37°C UNE ADN (digeste HindIII) b
Noël C/CCGGG Tampon rCutSmart™ 25 50 ADN pXba 3
XmnI GAANN/NNTTC Tampon rCutSmart™ 50 75 ADN b
ZrI CAG/CG Tampon rCutSmart™ 100 25 10 100 80°C 37°C B ADN

§ Une version HF de cette enzyme est disponible.

Notes de ligature et de redécoupage

Les notes suivantes apparaissent avec toutes les enzymes ayant des efficacités de ligature inférieures à 100 % telles qu'évaluées par ligature et redécoupage.

une. La ligature est inférieure à 10 %.
b. La ligature est de 25% -75%.
c. Le redécoupage après ligature est inférieur à 5%.
ré. Le redécoupage après ligature est de 50 à 75 %.
e. La ligature et le recoupage après ligature ne sont pas applicables car l'enzyme est soit une enzyme de coupure, est affectée par la méthylation, ou si l'enzyme clive en dehors de sa séquence de reconnaissance.

Notes d'activité des étoiles

Les notes suivantes apparaissent avec toutes les enzymes lorsque l'activité des étoiles est un problème.

1. L'activité Star peut résulter d'une digestion prolongée, d'une concentration élevée en enzyme ou d'une concentration en glycérol supérieure à 5%.
2. L'activité des étoiles peut résulter d'une digestion prolongée.
3. L'activité Star peut résulter d'une concentration de glycérol de > 5%.
*. Peut présenter une activité en étoile dans ce tampon.
+. Pour plus de flexibilité, NEB propose un isoschizomère ou une enzyme HF, fourni avec CutSmart Buffer.


Activité enzymatique de restriction

Les enzymes de restriction diffèrent par leur cinétique de réaction. Par conséquent, les variations par rapport au temps d'incubation recommandé, au nombre d'unités utilisées, à la quantité de substrat et/ou au volume réactionnel total doivent être prises en compte avec soin pour assurer une digestion complète. Le tableau suivant donne une indication de l'activité des enzymes de restriction Promega bleues/blanches qualifiées pour le clonage et le génome dans diverses conditions de réaction. Les variations du nombre d'unités enzymatiques utilisées et les temps d'incubation de la réaction ont été testés. Dans chaque cas, le volume de réaction (50 ul) et la quantité/type de substrat d'ADN (1 ug) étaient les mêmes que ceux utilisés dans l'essai de définition d'unité. Le temps d'incubation pour le dosage de définition d'unité est d'une heure.

Tableau 2.2. Activité enzymatique de restriction dans des conditions d'unités et de temps d'incubation non standard.
Enzyme Temps de réaction et nombre d'unités utilisées
15 min.
4 unités
15 min.
2 unités
15 min.
1 unité
30 minutes.
2 unités
1 heure
1 unité
2 heures
0,5 unités
4 heures
0,25 unités
AatII C je je C C C C
AccI C C C C C C je
Acc65I C je je C C je je
Apai C je je C C C C
AvaI C C je C C C C
BamHI C C je C C je je
BbuI C je je je C C C
Bcl je C je je C C C C
Bgl je C je je C C C C
BstXI C je je C C C C
BstZI je je je C C C C
ClaI C je je C C C C
CspI C je je C C je je
Csp45I C je je C C C C
Eco52I C je je C C je je
EcoRI C je je C C C C
EcoRV C je je C C C C
HincII C je je C C C C
HindIII C je je je C C C
KpnI C je je C C C C
MluI C je je C C C C
NcoI C je je C C C C
NheI C je je C C C C
pas je C je je C C C je
NsiI C je je C C C C
PstI C je je C C C C
SacI C je je C C C C
SacII C je je C C C C
Sal I C C C C C C je
SfiI C je je C C C C
SmaI C C je C C C C
SpéI C je je C C je je
SphI C C C C C je je
SspI C je je C C C C
StyI C je je C C je je
XbaI C je je C C C C
XhoI C je je C C C C
Noël C je je C C C C

« C » indique un clivage complet « I » indique un clivage incomplet pour les unités et les temps d'incubation indiqués.


Considérations relatives au substrat enzymatique de restriction

A. Source et structure du substrat

Les substrats couramment utilisés pour la digestion par des enzymes de restriction comprennent l'ADN phagique, l'ADN plasmidique, l'ADN génomique, les produits PCR et les oligonucléotides double brin. La concentration de l'échantillon d'ADN peut influencer le succès d'une digestion de restriction. Les solutions d'ADN visqueuses, résultant de grandes quantités d'ADN dans un volume trop petit, peuvent inhiber la diffusion et réduire considérablement l'activité enzymatique (1) . Des concentrations d'ADN trop faibles peuvent également inhiber l'activité enzymatique (voir Qualité du substrat). K typiquem les valeurs pour les enzymes de restriction sont comprises entre 1 nM et 10 nM et dépendent de la matrice (2) . Les concentrations finales d'ADN recommandées pour la digestion vont de 0,02 à 0,2µg/µl. Les variations structurelles du substrat, la concentration et les considérations spéciales sont discutées ci-dessous en fonction du type d'ADN.

ADN lambda : L'ADN lambda est un ADN linéaire qui est une norme industrielle pour la mesure et l'expression de l'activité unitaire pour la plupart des enzymes de restriction. En général, une unité suffit pour couper 1µg d'ADN lambda en 1 heure dans des conditions de réaction optimales dans un volume réactionnel de 50µl. Dans l'ADN lambda, le car extrémités, (surplombs monocaténaires complémentaires de 12 bases à l'extrémité de chaque molécule) peuvent s'hybrider à nouveau pendant la digestion. Cela peut donner l'impression que la digestion est incomplète. Pour éviter ce problème, chauffez l'ADN à 65°C pendant 5 minutes avant l'électrophorèse pour faire fondre les extrémités qui se sont hybridées.

ADN plasmidique : L'ADN plasmidique circulaire superenroulé a généralement une taille de 3 à 10 kb. Par rapport à l'ADN linéaire, les plasmides nécessitent souvent plus d'unités d'enzyme de restriction pour un clivage complet en raison du super (1) enroulement (1) ou du nombre total de sites à digérer (voir Reconnaissance de la densité du site). Voir Digestion de l'ADN plasmidique superenroulé pour plus d'informations sur les unités relatives nécessaires pour le clivage complet d'un vecteur plasmidique typique avec des enzymes de clonage communes. Si un plasmide superenroulé est d'abord linéarisé avec une autre enzyme de restriction ou relaxé avec la topoisomérase, moins d'enzyme peut être nécessaire pour la digestion.

ADN génomique : La digestion de l'ADN génomique peut être difficile en raison de la méthylation et de la viscosité. Si la méthylation est un problème, envisagez d'utiliser des isochizomères avec différentes sensibilités de méthylation (voir Sensibilité à la méthylation des paires isoshizomère/néoschizomère). La viscosité peut être ajustée en augmentant le volume de réaction. L'ADN génomique est souvent digéré plus efficacement lorsqu'il est dilué à une concentration minimale de 10µg par 50-200µl. Si cela n'est pas possible, le chauffage de l'ADN à 65 °C pendant dix minutes avant l'ajout de l'enzyme de restriction peut améliorer l'activité (3). Il a également été rapporté que l'ajout de spermidine à une concentration finale de 1 à 5 mM augmente l'activité enzymatique dans la digestion de l'ADN génomique (4) . L'ajout de BSA aux digestions de restriction à une concentration finale de 0,1 mg/ml peut également améliorer l'activité enzymatique.

Produits PCR : L'ADN amplifié par PCR peut être digéré avec des enzymes de restriction qui ont des séquences de reconnaissance dans la séquence amplifiée ou dans les régions d'amorce. Le nombre d'unités enzymatiques nécessaires doit être équilibré avec le nombre total de sites pour assurer un clivage complet. Des temps d'incubation plus longs peuvent être nécessaires pour assurer une digestion complète. Les enzymes avec de faibles valeurs de surdigestion (<12 unités/16 heures) doivent être évitées dans les digestions nocturnes, car l'activité des étoiles ou les traces de contaminants présents dans ces enzymes peuvent entraîner des problèmes. Consultez la fiche d'information sur le produit Promega pour connaître la valeur de surdigestion de l'enzyme. Pour de nombreuses enzymes de restriction courantes, une activité acceptable est observée dans le tampon PCR, bien que la digestion après amplification puisse ne pas aboutir aux extrémités compatibles attendues en raison de l'activité polymérase résiduelle (5). La digestion vers la fin d'un produit PCR peut également présenter des problèmes. Les enzymes de restriction nécessitent des quantités variables d'ADN flanquant autour du site de reconnaissance, généralement de 1 à 3 bases mais parfois plus (voir Digestion des sites proches de la fin de l'ADN linéaire). Si une amorce oligonucléotidique est conçue avec un site de coupure trop proche de l'extrémité de l'ADN, le site peut mal ou pas du tout coupé. Puisqu'il est très difficile de déterminer la coupure près de la fin de l'ADN, l'efficacité de la compensation avec des unités enzymatiques supplémentaires ou un temps d'incubation accru est difficile à déterminer. L'utilisation d'enzymes de relecture en PCR peut également compliquer la situation car ces enzymes sont capables de dégrader les extrémités 3´s des amplimères, interférant avec la digestion complète par les enzymes de restriction. L'utilisation de concentrations élevées de dNTP et le refroidissement immédiat à 4°C après PCR réduiront cette dégradation. Une autre raison de la digestion incomplète des fragments PCR peut être les dimères d'amorces. Si le site de restriction est intégré à l'amorce, les dimères d'amorce contiendront une version double brin du site, généralement en excès molaire considérable par rapport à celui du fragment PCR cible souhaité. Ce problème peut être facilement évité en purifiant le fragment PCR avant la digestion par les enzymes de restriction à l'aide du système de purification d'ADN Wizard® PCR Preps (Cat.# A7170).

Oligonucléotides double brin : Bon nombre des mêmes considérations pour les produits PCR s'appliquent à la digestion d'oligonucléotides double brin. Dans ce cas, des densités élevées de sites de reconnaissance par unité de masse peuvent être présentes et le site peut également être proche de l'extrémité de la molécule d'ADN. Encore une fois, des temps de digestion plus longs et/ou plus d'enzymes peuvent être nécessaires. Les enzymes avec une faible spécification de surdigestion (12 unités/16 heures) doivent être évitées dans les digestions nocturnes.

ADN simple brin : Le clivage de l'ADN simple brin, bien qu'à un taux considérablement réduit par rapport à l'ADN double brin, a été signalé pour quelques enzymes de restriction (6) . Des études ont montré, cependant, que plusieurs enzymes de restriction qui semblent cliver l'ADN simple brin reconnaissent en fait les régions duplex repliées dans les génomes simple brin (par exemple, M13, f1, phiX174 simple brin) (7) (8) . Par conséquent, ces enzymes ne digèrent pas l'ADN simple brin, mais des sites individuels qui sont sous forme de duplex.

Hybrides ADN-ARN : La digestion de molécules hybrides ADN-ARN a été décrite pour plusieurs enzymes de restriction (AluI, EcoRI, HaeIII, HhaI, HindIII, MspI, SalI, Thal) (9). Dans ces cas, le brin d'ADN de l'hybride a été digéré au même endroit que l'ADN duplex. La digestion nécessitait des taux d'enzymes 20 à 50 fois plus élevés que ceux nécessaires pour l'ADN duplex. Il est possible mais non prouvé que l'ARN ait également été clivé avec de grands excès d'enzyme.

Influence de la séquence de flanquement : Les séquences flanquant la séquence de reconnaissance des enzymes de restriction peuvent influencer le taux de clivage de nombreuses enzymes de restriction bien que les différences soient généralement inférieures à 10 fois. Un petit nombre d'enzymes (par exemple, Nael, HpaII, SacII, NarI, EcoRII) présentent des préférences de site plus prononcées et sont désignées de type IIe. Voir Préférences du site et Enzymes de restriction Turbo&trade pour plus d'informations.

Méthylation : La méthylation des nucléotides dans les séquences de reconnaissance des enzymes de restriction peut affecter la digestion. La méthylation peut se produire sous forme de 4-méthylcytosine, 5-méthylcytosine, 5-hydroxyméthylcytosine ou 6-méthyladénine dans l'ADN de bactéries (y compris les plasmides), d'eucaryotes et de leurs virus. La sensibilité, ou l'absence de celle-ci, à la méthylation spécifique au site, est connue pour de nombreuses enzymes de restriction (10) . Souvent, les isoschizomères diffèrent par leur sensibilité à la méthylation. Reportez-vous à la cat. # A1330) fournissent un moyen simple et efficace d'isoler et de purifier l'ADN, sans sel ni contaminants macromoléculaires. L'ajout de spermidine à une concentration finale de 1 mM et/ou de BSA à une concentration finale de 0,1 mg/ml peut également améliorer la digestion d'ADN miniprep de mauvaise qualité.

ADN génomique : L'ADN génomique contient fréquemment plus de contaminants que l'ADN plasmidique. Les meilleurs résultats sont obtenus lorsque les rapports d'absorbance à A260/UNE280 sont d'au moins 1,8. La spermidine peut être ajoutée à une concentration finale de 1 mM et/ou BSA à une concentration finale de 0,1 mg/ml pour améliorer la digestion de l'ADN génomique de mauvaise qualité. Pour plus d'informations, voir Digestion de l'ADN de haut poids moléculaire.

ADN génomique intégré dans des bouchons d'agarose : L'électrophorèse sur gel en champ pulsé permet la résolution de fragments d'ADN extrêmement volumineux. L'ADN génomique purifié par des techniques traditionnelles peut contenir des cassures double brin dues aux forces de cisaillement mécaniques. De telles ruptures peuvent être une source d'arrière-plan dans le mappage de mégabases de fragments de 50-1000kb. Pour éviter cela, les cellules de mammifères, bactériennes et de levure peuvent être incorporées dans des bandes d'agarose et les cellules lysées et traitées avec la protéinase K in situ (11) . La plupart des enzymes de restriction peuvent couper l'ADN inclus dans l'agarose à condition d'utiliser plus d'enzymes et des temps d'incubation plus longs. Une bonne règle de base est d'utiliser 5 à 10 unités d'enzyme par microgramme d'ADN et d'éviter d'utiliser des enzymes de restriction avec de faibles valeurs de surdigestion (<20 unités/16 heures), ce qui peut causer des problèmes lors d'incubations plus longues avec un excès d'enzyme. Pour plus d'informations, reportez-vous à Digestion de l'ADN de haut poids moléculaire.

ADN génomique purifié à partir de sang. L'anticoagulant utilisé lors du prélèvement sanguin peut affecter la capacité des enzymes de restriction à digérer complètement l'ADN. Utilisez l'EDTA comme anticoagulant plutôt que l'héparine, qui peut se lier étroitement à l'enzyme et interférer avec la digestion. Les taux d'absorbance à A260/UNE280 doit être d'au moins 1,8, indiquant que la protéine a été éliminée efficacement. Un certain nombre de protocoles de purification rapide de l'ADN ont été écrits qui ne nécessitent pas de séparation des globules blancs des globules rouges (12) (13) . Ces techniques peuvent produire un ADN de bonne qualité à partir de petits volumes de sang, mais l'ADN obtenu après la mise à l'échelle peut être de moins bonne qualité. Pour les échantillons de sang plus volumineux, une technique qui sépare les globules blancs des globules rouges, telle que le culottage des globules rouges à travers un gradient Ficoll®, est recommandée avant la purification de l'ADN.

Promega propose le kit de purification d'ADN génomique Wizard® (Cat. # A1120) pour l'isolement d'ADN génomique à partir de globules blancs (avec réactifs/protocole pour l'élimination des globules rouges), cellules de culture tissulaire, tissus animaux, tissus végétaux et Gram-positif et Bactéries à Gram négatif. L'ADN purifié avec ce système convient à la digestion avec des enzymes de restriction.

Produits PCR : Les contaminants de la PCR tels que les sels, le glycérol et les dimères d'amorces peuvent inhiber l'activité des enzymes de restriction. Le système de purification d'ADN Wizard® PCR Preps (Cat. # A7170) fournit une méthode fiable pour la purification de l'ADN double brin amplifié par PCR à partir de tout sel ou contaminant macromoléculaire.

C. Densité du site de reconnaissance

Les unités d'activité des enzymes de restriction sont généralement définies sur la base d'une digestion d'une heure de 1 & microg d'ADN lambda. Lors de la digestion d'autres substrats, des ajustements peuvent être nécessaires en fonction de la quantité de substrat, du nombre de sites de reconnaissance par molécule et du temps d'incubation. Le tableau suivant illustre l'effet des différences de sites de reconnaissance de substrat par molécule pour ÉcoR I tout en maintenant la masse de substrat et le temps d'incubation constants.

Tableau 2.3. Différences dans les sites de reconnaissance de substrat pour EcoR I.
Substrat d'ADN Base
Paires
Picomoles
en 1µg*
Couper les sites
(EcoRI)
Picomoles
Couper les sites
Unités
Nécessaire
Définition de l'unité (lambda) 48,502 0.0317 5 0.1585 1
plasmide 3,000 0.5 1 0.5 3**
Fragment PCR 700 2.2 1 2.2 14
oligonucléotide 25 62.5 1 62.5 394

*Basé sur 650 Daltons par paire de bases d'ADN.
** Les enzymes diffèrent dans leur capacité à digérer les substrats superenroulés par rapport aux substrats linéaires.

Les références

  1. Fuchs, R. et Blakesley, R. (1983) Guide d'utilisation des endonucléases de restriction de type II.méth. Enzymol.101, 3.
  2. Wells, R., Klein, R. et Singleton, C.K. (1981) Dans : Les Enzymes XIV 157.
  3. Hinds, K., Shamblott, M. et Litman, G. (1991) Dans : Méthodes de recherche sur les acides nucléiques, Karam, J., Chao, L. et Warr, G. eds., CRC Press.
  4. Bloch, K. (1987) Dans : Protocoles actuels en biologie moléculaire, Ausubel, F.M. et al., éd., Green Publishing Associates.
  5. Turbett, G.V. et Sellner, L.N. (1996) Digestion de produits PCR et RT-PCR avec des endonucléases de restriction sans purification ni précipitation préalable. Notes de Promega60, 23&ndash7.
  6. Yoo, O.J. et Agarwal, K.L. (1980) Clivage d'oligonucléotides simple brin et d'ADN du bactériophage phiX174 par l'endonucléase Msp I.J. Biol. Chem.255, 10559&ndash62.
  7. Nevendorf, S. et Wells, R. (1980) Dans : Amplification et analyse de gènes : endonucléases de restriction. Vol. I, Chirikjian, J., éd., Elsevier, Hollande du Nord.
  8. Blakesley, R.W. et al. (1977) Les régions duplex dans l'ADN phiX174 "simple brin" sont clivées par une endonucléase de restriction de Haemophilus aegyptius.J. Biol. Chem.252, 7300&ndash6.
  9. Molloy, P.L. et Symons, R.H. (1980) Clivage des hybrides ADN.ARN par des enzymes de restriction de type II.Acides nucléiques Res.8, 2939.
  10. McClelland, M. et al. (1994) Effet de la modification spécifique au site sur les endonucléases de restriction et les méthyltransférases de modification de l'ADN.Acides nucléiques Res.22, 3640&ndash59.
  11. McClelland, M. et al. (1987) Endonucléases de restriction pour la cartographie en champ pulsé des génomes bactériens.Acides nucléiques Res.15, 5985&ndash6005.
  12. Miller, S.A., Dykes, D.D. et Polesky H.F. (1988) Une procédure de relargage simple pour extraire l'ADN de cellules nucléées humaines.Acides nucléiques Res.16, 1215.
  13. Grimberg, J. et al. (1989) Une procédure non organique simple et efficace pour l'isolement de l'ADN génomique du sang.Acides nucléiques Res.17, 8390.

Clivage enzymatique de restriction : enzymes &lsquosuniques&rsquo et enzymes&lsquomulti-site&rsquo

Les enzymes de restriction sont des protéines utilisées pour fragmenter et cloner l'ADN, mais leur fonction biologique est de protéger les bactéries et les archées contre les infections virales. Tous se lient à l'ADN double brin (ds) au niveau de séquences spécifiques de paires de bases (la « séquence de reconnaissance ») et clivent les brins d'ADN. Compte tenu de leurs similitudes catalytiques, nous pourrions nous attendre à ce que toutes les enzymes de restriction soient similaires, mais elles sont en fait extrêmement diverses et varient considérablement en termes de séquence d'acides aminés, de structure tridimensionnelle, de composition de sous-unités et de modes d'action. Les enzymes de restriction de spécificité identique (&lsquoisoschizomers&rsquo) sont parfois similaires, et représentent des versions divergentes de la même protéine ancestrale, mais celles de spécificité différente sont souvent uniques, et ne présentent pas plus de similitude entre elles qu'avec des protéines non apparentées choisies au hasard. Il semble probable que les enzymes de restriction sont apparues indépendamment plusieurs fois au cours de l'évolution microbienne et dans des circonstances variées.

Cette diversité s'accompagne de subtiles différences dans le comportement des enzymes de restriction. Dans une comparaison, sept enzymes qui clivent la séquence GGCGCC à quatre positions différentes ont été examinées et cinq voies de réaction distinctes ont été discernées (1). La différence mécanistique peut-être la plus importante lors de l'utilisation d'enzymes de restriction comme réactifs de biologie moléculaire concerne le nombre de sites de reconnaissance auxquels une enzyme de restriction doit se lier pour se cliver. La plupart des enzymes de restriction agissent comme des monomères simples (une chaîne protéique, par exemple MspI (NEB #R0106) (2)) ou des homodimères (deux chaînes protéiques identiques, par exemple BamHI (NEB #R3136)), qui se lient et clivent un site de reconnaissance à la fois . Ces enzymes coupent les substrats avec un site aussi efficacement qu'elles coupent les substrats avec plusieurs sites. D'autres sont plus complexes, et subissent une activation allostérique, ou forment des dimères "lsquottransients" (eg FokI (NEB #R0109) (3-5)), des tétramères (eg NgoMIV (NEB #R0564) (6)), ou encore des assemblages plus importants (eg BcgI (NEB #R0545) (7, 8)), et ceux-ci ne coupent que lorsqu'ils sont liés à deux, et parfois plus (9), sites à la fois. Dans certains cas, ce comportement &lsquomulti-site&rsquo, pourrait être une adaptation contre le clivage accidentel de l&rsquo ADN de la bactérie. Structurellement, cela provient probablement des organisations de sous-unités des enzymes et de la façon dont leurs domaines de reconnaissance et catalytiques s'emboîtent (8). Indépendamment du pourquoi et du comment, la nécessité de se lier à plus d'un site afin de cliver peut rendre les substrats avec un seul site difficiles à couper in vitro.

Les enzymes de restriction qui se lient à plusieurs sites pour cliver présentent plusieurs caractéristiques :

    Cinétique de clivage. Les substrats avec des sites uniques sont clivés lentement et dans certains cas de manière incomplète car les enzymes doivent interagir avec (&lsquobridge&rsquo) deux molécules d'ADN ou plus à la fois. La probabilité de le faire diminue précipitamment à de faibles concentrations d'ADN. L'ajout de plus d'enzymes pour essayer d'améliorer le clivage dans cette situation peut faire le contraire et aggraver les choses, car l'augmentation de la concentration en enzyme réduit en effet la concentration relative du substrat (voir #2 ci-dessous). Si les contacts entre les sous-unités sont fragiles, comme on le pense pour les dimères transitoires tels que FokI (NEB #R0109) (10), alors les enzymes pontant les sites en trans, dans différentes molécules, peuvent être instables et inefficaces. En revanche, lorsque plusieurs sites sont présents dans la même molécule d'ADN, la concentration locale de sites est plus élevée et les sites de pontage des enzymes en cis sont plus stables, ce qui conduit tous deux à un clivage plus rapide et plus complet. Les enzymes multisites varient dans le degré auquel elles sont affectées par ces facteurs et des facteurs connexes. Certains, tels que BspMI/BfuAI (NEB #R0502) (11) et NmeAIII (NEB #R0711) clivent à peine les substrats à 1 site. D'autres (par exemple, SacII (NEB # R0157) coupé partiellement, et d'autres encore (par exemple PluTI (NEB # R0713)) peuvent se scinder en quasi-achèvement.

Compte tenu de la diversité des enzymes de restriction, de nombreuses exceptions se produisent, mais les enzymes à site unique et à sites multiples se répartissent assez bien en deux groupes distincts en fonction des positions de clivage.

    Enzymes à site unique. La majorité des enzymes de restriction qui clivent à l'intérieur ou très près de leur séquence de reconnaissance sont actives sur des sites uniques. Ces enzymes sont classées en &lsquoType IIP&rsquo si leurs séquences sont palindromiques (symétriques), et &lsquoType IIT&rsquo si leurs séquences sont asymétriques et que deux sites catalytiques différents sont utilisés pour cliver les brins d'ADN. Ils clivent complètement les substrats d'ADN avec un seul site aussi efficacement qu'ils clivent des substrats avec plusieurs sites. Leur capacité de clivage n'est pas inhibée à une concentration en enzyme élevée en raison de la saturation du site, et n'est pas améliorée par l'ajout d'oligos spécifiques.

Les enzymes de type IIT AciI (NEB #R0551) et EarI (NEB #R0528) sont des exceptions possibles à cette généralisation, tout comme plusieurs enzymes de type IIP. Ces enzymes clivent lentement les substrats à 1 site et, dans certains cas, le clivage est incomplètement inhibé à des concentrations d'enzymes élevées en raison de la saturation du site et le clivage peut être amélioré par l'ajout d'oligos spécifiques. Ces exceptions d'enzymes de type IIP incluent : AluI (NEB #R0137) BsaWI (NEB #R0567) (25) BsrFI/Cfr10I (NEB #R0562) (14,19,20) Ecl18kI (12,18) EcoRII (9,17,19 ,20) HpaII (NEB #R0171) (19,20) NaeI (NEB #R0190) (13,24,26,27) NarI/Mly113I (NEB #R0191) (1,19,20,24,28) NgoMIV ( (NEB #R0564) 6) PluTI/BbeI (NEB #R0713) (1) RsrII (NEB #R0501) SacII/Cfr42I (NEB #R0157) (19,29) Sau3AI (NEB #R0169) (19,20) SfiI ( NEB #R0123) (16,30-35) SgrAI (NEB #R0603) (19,20,36-38) SmlI et XmaI/Cfr9I (NEB #R0180) (19,24), qui agissent tous à un degré ou un autre en tant qu'enzymes multi-sites.

RECOMMANDATIONS

Si vous utilisez une enzyme qui peut nécessiter plus d'un site de reconnaissance sur le substrat pour un clivage optimal, nous suggérons deux méthodes d'optimisation possibles : 1) Titrer les unités d'enzyme utilisées dans la réaction pour déterminer le rapport enzyme/substrat optimal. Comme point de départ, nous recommandons d'utiliser 1-2 &mul d'enzyme de restriction (aux unités/&mul fournies) par microgramme de substrat et d'effectuer des dilutions en série de 2 de l'enzyme, en maintenant la concentration d'ADN constante. 2) Si cela n'est pas possible, ajoutez des oligonucléotides duplex qui contiennent le site de reconnaissance. Les oligos fournissent le site de reconnaissance supplémentaire nécessaire pour activer les monomères enzymatiques liés au substrat mais dormants. L'ajout d'ADN duplex contenant un site de reconnaissance peut entrer en compétition pour la liaison et réduire la concentration efficace en enzyme. Pour utiliser efficacement les oligos, la stoechiométrie de la réaction doit être établie au préalable en effectuant une série de titrages et en identifiant la plage optimale pour la concentration des oligos. Nous recommandons de maintenir la concentration en enzyme constante à 2 à 4 fois au-dessus de l'optimum établi à l'étape 1 ci-dessus, tout en effectuant des dilutions en série de 2 fois de l'oligo. Comme point de départ, nous recommandons un rapport de 4:1 (sites oligo:sites substrats) et effectuer une dilution en série de 2 de l'oligo, en maintenant les concentrations d'enzyme et de substrat constantes.