Informations

Séquençage du génome entier vs séquençage de l'exome entier


Je travaille sur un projet où je veux découvrir les gènes responsables d'une certaine maladie que je pourrais avoir. Je me demandais s'il fallait demander à WGS ou à WES d'effectuer cette expérience : -

Je regarde les SNP et les CNV de mes gènes et je veux comparer mes données avec celles d'individus normaux et malades. Pour un gène, je calcule la distance du document pour chaque groupe (normal et malade) à l'aide de cet algorithme (https://math.stackexchange.com/questions/1080377/how-close-apart-are-two-message-document-distance- algorithme) car cela me permettra de déterminer quels gènes j'ai qui sont anormaux ou sont "proche" d'être classés comme anormaux et quels gènes sont normaux ou "proche" d'être appelés normaux selon l'algorithme et les données obtenues des deux groupes .

Pour réaliser cette expérience, je dois séquencer mon génome ET identifier des bases de données qui me permettraient de faire mon analyse. Je voulais savoir ce qui est le mieux pour mon expérience WGS ou WES, car les données accessibles au public pourraient également influencer la décision.

De plus, je pense que l'épissage alternatif ajoute une couche de complexité et je voulais savoir pourquoi WES est exécuté de toute façon.

Merci d'avance pour vos réponses. S'il vous plaît, répondez tout ce que vous pouvez. Encore merci!


WES, presque certainement. Tout d'abord, la grande majorité des variants à l'origine du phénotype se trouvent dans les exons. Pour la plupart des analyses qui examinent les mutations causant des maladies, le WGS est inutile. Cela ne fait que rendre votre analyse plus difficile et n'ajoute rien d'utile.

Si tu savoir vous êtes intéressé par les CNV, c'est différent. La détection de CNV est difficile en général mais est particulièrement difficile à partir des données WES. La détection des CNV dans les données WGS est beaucoup moins sujette aux erreurs. Cependant, vous devez vraiment garder à l'esprit qu'il n'existe actuellement aucune «bonne» méthode pour détecter les CNV. C'est un problème non trivial et encore à ses balbutiements. Bien qu'il existe différentes méthodes pour détecter les CNV, aucune d'entre elles ne les trouve toutes (ni même presque toutes). En fait, c'est un tel problème sur le terrain que la sagesse actuellement acceptée est que vous devez utiliser plusieurs méthodes et combiner les résultats. En fait, de nombreux détecteurs CNV récents font exactement cela. Et ils toujours ne les trouvez pas tous (surtout pas dans les données WES). Fondamentalement, la détection de CNV n'est pas pour les timides et n'est certainement pas pour les non-experts.

La bonne nouvelle est que si vous avez une mutation causant une maladie, il est très peu probable qu'il s'agisse d'une NVC. Il est beaucoup plus probable que vous recherchiez simplement des SNP. Ce qui nous amène au prochain numéro. Je crains que l'algorithme auquel vous vous êtes lié, d'après ce que je peux dire, ne vous aide du tout. Vous n'essayez pas de comparer votre gène à une liste de gènes sains et malsains et de déterminer quel groupe est le plus similaire à celui que vous avez. Tout d'abord, parce qu'il existe de nombreuses différences (mutations) qui n'ont en fait aucun effet. Ces mutations dites synonymes seraient toujours comptées par votre algorithme mais devraient être ignorées. Deuxièmement, parce que de minuscules différences peuvent être extrêmement importantes. Il existe des outils spécifiques pour ce que vous voulez faire ; n'essayez pas d'appliquer des approches mathématiques générales et larges. Vous avez besoin d'algorithmes spécialement conçus pour traiter les données biologiques et qui prennent en considération la biologie sous-jacente.

Donc, ce que vous recherchez, ce sont des programmes appelés "Variant Callers". Deux des plus populaires sont GATK et FreeBayes. Ceux-ci liront un génome d'entrée et le compareront à un génome de référence et vous donneront une liste de "variantes", des sites où l'entrée diffère de la référence. Vous souhaitez ensuite utiliser des ressources telles que ClinVar ou MutationTaster pour vérifier si ces variantes sont considérées comme pathogènes. C'est un peu d'auto-promotion éhontée puisque je travaille pour l'entreprise qui l'a créée, mais VarSome, "The Human Genomic Variant Search Engine" est un nouveau moteur de recherche de variantes qui combine des informations provenant de nombreuses sources différentes dans un moteur de recherche centralisé et facile à rechercher. dépôt. Je le recommande vivement (et c'est gratuit).

Cependant, avant de trouver vos variantes, vous devrez aligner votre génome sur la référence. Fondamentalement, les méthodes de séquençage modernes fonctionnent en coupant le génome en de très nombreux petits morceaux, en copiant chaque morceau plusieurs fois, puis en séquenceant chaque morceau. Ainsi, la sortie d'une exécution de séquençage est un fichier texte qui ressemble à ceci :

@ SN956: 1934: H55WMBBXX: 2: 1101: 0: 15733 1: N: 0: NTTACTCG NCCCCAAGGAGACTTGCTGAGACCTTGAACAAGTGACACAATGTGAGCAGAACTTGTCTTGACAGAAAATGCTTTG + # AAAFJJJJJJJJJFFJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJAJJJJFAJJJJJFJJ7 @ SN956: 1934: H55WMBBXX: 2: 1101: 0: 15743 1: N: 0: NTTACTCG NCTTCCTCACTAAAGTCCCATTTAGTGCTGATTGTGCTTTGGCTACTTCTCCTCTTGCCATTTTCCTGAACCCACG + #AAFFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJF

Il s'agit généralement de plusieurs gigaoctets (quelque chose comme ~2-3G pour WES et >80G pour WGS). Par conséquent, l'alignement de ces séquences nécessite une machine puissante et vous ne voulez même pas essayer d'aligner des séquences WGS sur votre ordinateur portable. Cela prendra des semaines et échouera probablement. Une autre raison pour laquelle vous devriez préférer WES à WGS pour cela. Dans mon travail, j'aligne régulièrement les données WGS sur le génome de référence et cela peut facilement prendre > 100 Go de RAM.

L'essentiel et ce que cette réponse décousue essaie de faire comprendre, c'est que :

  • WES est meilleur que WGS lors de la recherche de mutations causant des maladies. Il est beaucoup plus facile d'analyser les données et 99% des cas souhaités sont dans des exons. C'est aussi beaucoup, beaucoup moins cher.
  • Ce n'est pas simple. Vous semblez penser que vous pouvez en quelque sorte entrer et le faire vous-même. Vous pouvez, mais c'est très loin d'être anodin. Ce n'est pas bon marché non plus.

Donc, si vous avez réellement de l'argent pour payer une analyse WGS (cela coûte plusieurs milliers d'euros/dollars, au cas où vous ne le sauriez pas), ce qui est très surprenant si vous n'êtes qu'un particulier, au lieu de le dépenser sur WGS, obtenez un WES et dépensez votre argent pour faire appel à un expert pour analyser vos données pour vous. Sérieusement, c'est ce que je fais dans la vie, tu n'as vraiment pas l'air d'avoir compris à quel point c'est compliqué. Et non, je ne vous suggère pas de m'engager :). Il existe cependant des entreprises qui proposent ce type de service. Utilisez-les, ne réinventez pas la roue.

Les références

Articles de revue utiles pour la détection de CNV :

  1. Zhao et al. BMC Bioinformatique, 2013, 14(Suppl 11) : S1 (DOI : 10.1186/1471-2105-14-S11-S1, lien)
  2. Tattini L, D'Aurizio R et Magi A Devant. Bioeng. Biotechnologie, 2015. 3:92. (DOI : 10.3389/fbioe.2015.00092, lien)

Séquençage WES vs WGS : avantages et inconvénients

Le séquençage massivement parallèle de l'ADN a créé une nouvelle ère pour la technologie génomique, permettant le séquençage de milliers à des millions de molécules d'ADN simultanément. Des progrès remarquables ont eu lieu dans les domaines de la médecine personnalisée, de la génétique et du diagnostic clinique. L'évolution de la technologie de séquençage a créé d'innombrables opportunités et applications dans le domaine des sciences biologiques et a considérablement réduit les coûts de séquençage. De plus, le logiciel d'interprétation et d'analyse des données DNA-seq s'est également amélioré (Berglund, Kiialainen, & Syvänen, 2011).

Les pratiques cliniques de routine ont commencé à intégrer le séquençage du génome entier (WGS) et le séquençage de l'exome entier (WES). Les applications de WES et WGS ont déjà accéléré la découverte et le diagnostic de troubles génétiques (Bick & Dimmock, 2011).

Bien que les technologies de séquençage soient devenues rentables et rapides, de nombreux chercheurs continuent de préférer le WES au WGS. L'exome est considéré comme le modèle d'un organisme et a tendance à contenir toutes les réponses. Récemment, un débat a été soulevé sur le fait que cette entité codant pour les protéines ne détient pas toutes les réponses. Des mutations en dehors des régions codant pour les protéines peuvent également affecter le phénotype d'un organisme en affectant l'activité des gènes.

Séquençage de l'exome entier par rapport au séquençage du génome entier

WES est une technique de séquençage de nouvelle génération (NGS) pour le séquençage des régions codant pour les protéines du génome, collectivement appelées exome, qui ne constituent que 1% du génome. Le WGS, quant à lui, est une technique permettant de séquencer la séquence complète d'ADN d'un organisme en une seule fois.

Les techniques et les plates-formes de séquençage pour WES et WGS sont plus ou moins les mêmes, à l'exception d'une étape supplémentaire requise dans WES appelée enrichissement de la cible. L'enrichissement de la cible est effectué avant le séquençage afin de capturer sélectivement la région génomique (exome). Les techniques d'enrichissement des cibles comprennent la capture par hybridation en phase solide et l'hybridation en phase liquide (Teer & Mullikin, 2010).

Analyse des données ADN-seq

Une fois le séquençage terminé, une analyse ADN-seq est effectuée. L'analyse DNA-seq comprend une variété d'évaluations bioinformatiques, qui sont plus ou moins les mêmes pour le WGS et le WES. Des mutations somatiques et germinales peuvent également être identifiées qui peuvent aider au diagnostic d'une maladie ou d'une affection génétique. Il existe de nombreux outils et progiciels en ligne gratuits capables d'effectuer une analyse ADN-seq, bien que la plupart nécessitent des connaissances en programmation et en bioinformatique (Grada & amp Weinbrecht, 2013).

Nature de l'étude : quand utiliser WGS et WES ?

Les régions non exoniques occupent environ 98,8 % du génome, mais sont mal caractérisées et comprises. Par conséquent, le WGS est principalement effectué dans des études d'analyse d'ADN-seq basées sur la recherche pour mieux comprendre ces régions non exoniques du génome.

Les cliniciens, d'autre part, considèrent le WES comme une technique plus favorable pour le diagnostic des maladies au niveau génétique. Les cliniciens utilisent WES pour identifier les mutations génétiques responsables d'une grande variété de troubles, notamment les déficiences intellectuelles, le cancer, les maladies immunologiques et autres (Angelo DePalma, 2018). WES, cependant, peut ignorer des mutations accidentelles responsables de maladies rares. Ces troubles peuvent provoquer une perturbation phénotypique potentielle dans la vie d'un individu. Par conséquent, le WGS est généralement mené pour enquêter sur ces troubles rares (Grada & Weinbrecht, 2013).

Coût et temps

Le coût estimé du WES varie de 5 à 169 et il est principalement utilisé dans les enquêtes cliniques pour économiser de l'argent et du temps. Auparavant, le coût estimé du WGS était de 15 146 $ en 2013 pour une plate-forme non spécifiée, mais le lancement récent de la plate-forme de séquençage Illumina HiSeq X Ten a considérablement réduit le coût du WGS à 1 906 $. WES n'a plus d'avantage de prix sur WGS pour l'étude des organismes inférieurs (par exemple, les bactéries) cependant, dans les études cliniques, WES prend toujours la tête sur WGS (Schwarze, Buchanan, Taylor, & Wordsworth, 2018).

Un phénotype peut être le résultat d'une seule mutation (troubles mendéliens) ou de plusieurs mutations dans un génome. Ces mutations se produisent généralement dans un exome, régions codant pour les protéines du génome, mais les mutations non exoniques peuvent également affecter l'activité des gènes. WES manque potentiellement les variations non exoniques, et il ne parvient pas non plus à capturer les mutations accidentelles.

La plupart des régions non exoniques d'un génome sont mal caractérisées et comprises. Par conséquent, les données générées par WGS sont complexes et difficiles à interpréter. La barrière des coûts et du temps a été récemment levée avec le lancement de la plateforme de séquençage Illumina HiSeq X Ten.

En fin de compte, WES et WGS ont tous deux de solides partisans. Il est cependant difficile de dire que l'un est meilleur ou pire que l'autre, car leur utilité dépend fortement de l'objectif d'une étude ou d'une expérience. Ce qui est clair, c'est que le séquençage du génome entier et de l'exome entier sont des technologies de séquençage de nouvelle génération très populaires qui ont aidé les chercheurs à mieux comprendre l'interaction entre la génétique et la maladie.


Qu'est-ce que le séquençage du génome entier ?

Le séquençage du génome entier (WGS) est une méthode complète d'analyse de l'intégralité de la séquence d'ADN génomique d'une cellule en une seule fois. WGS est une technologie qui permet aux scientifiques de lire la séquence exacte de toutes les lettres qui composent votre ensemble complet d'ADN. Le génome humain est encore mal connu et même la partie la mieux étudiée du génome est représentée par environ 3% du génome qui code les protéines. Et les fonctions des protéines du génome humain sont également partiellement comprises. Pour ces raisons, l'analyse informatique des données de séquence du génome vise à identifier la signification médicale de tous les éléments fonctionnels du génome et à identifier les fonctions des gènes et leur implication dans la maladie. Le WGS utilisant les technologies NGS devrait révolutionner les soins cliniques, mais la promesse générale du séquençage du génome entier est loin d'être tenue. Le WGS consiste à séquencer l'ensemble du génome pour étudier les mutations et les réarrangements.


Panels de gènes ciblés vs séquençage de l'exome entier

Une question fréquente que nous entendons sur Genohub est : « devrais-je créer un panel personnalisé pour cet ensemble de gènes, ou ne pas prendre la peine de faire un séquençage complet de l'exome ? ». Alors que les approches de séquençage du génome entier peuvent capturer toutes les mutations possibles, le séquençage de l'exome entier ou du panel de gènes ciblés sont des approches rentables pour capturer les mutations modifiant le phénotype. Nous abordons les avantages de WGS par rapport à WES dans un article de blog précédent. Une question en suspens est cependant, parmi les approches de ciblage, quelle est la meilleure. Nous tentons de résoudre ce problème ici :

Avantages du ciblage de tous les exons – séquençage de l'exome entier (WES)

Si votre étude est basée sur la découverte, en d'autres termes, vous ne savez pas quels gènes vous devez cibler, WES est le choix évident.

  • Mieux pour les applications basées sur la découverte où vous n'êtes pas sûr des gènes que vous devriez cibler.
  • Les panneaux Exome sont disponibles dans le commerce, ils n'ont pas besoin d'être personnalisés ou conçus.
  • Les services de séquençage de l'exome sont assez standard, les coûts varient entre 550 et 800 $ pour une couverture moyenne de 100 à 150x.

Avantages des panels de gènes ciblés (amplicon-seq ou méthodes d'hybridation ciblées)

Les panels de gènes ciblés sont idéaux pour analyser des mutations ou des gènes spécifiques suspectés d'être associés à une maladie.

  • Se concentrer sur des gènes individuels ou des régions de gènes vous permet de séquencer à une profondeur beaucoup plus élevée que exome-seq, par ex. 2 000 à 10 000 x par opposition à 200 x ce qui est typique avec exome-seq.
  • Le séquençage à grande profondeur permet l'identification de variants rares
  • Peut être personnalisé pour différents types d'échantillons, par ex. FFPE, cf/ctDNA, échantillons dégradés.
  • Des quantités d'entrée plus faibles peuvent être utilisées avec des panels de gènes ciblés (1 ng contre 100 ng avec le séquençage de l'exome entier).
  • Les panels de gènes peuvent être personnalisés pour n'inclure que les régions génomiques d'intérêt. Pourquoi tout séquencer quand vous n'avez pas besoin de ces informations supplémentaires ?
  • Les panneaux peuvent être facilement conçus pour des espèces non humaines. Concevoir un exome non humain est beaucoup plus laborieux.
  • Les flux de travail du panel de gènes sont beaucoup plus simples et le délai d'obtention des résultats est souvent de 1 à 2 jours seulement.
  • Vous pouvez traiter des milliers d'échantillons en un seul cycle de séquençage. Les panels de gènes ciblés peuvent être exécutés à un débit plus élevé et sont souvent plus rentables que le séquençage de l'exome entier.

En vous concentrant sur les gènes susceptibles d'être impliqués dans la maladie, vous pouvez réduire les dépenses et concentrer les ressources de séquençage sur votre région cible. Cependant, si vous n'avez que quelques échantillons à séquencer à faible profondeur de couverture, demandez-vous s'il vaut la peine de concevoir un panel plutôt que d'effectuer un séquençage complet de l'exome à l'aide d'un panel commercial existant.

Si vous êtes intéressé par la conception d'un panel de gènes personnalisé ou si vous avez déjà un panel existant que vous souhaitez séquencer, soumettez une demande décrivant votre projet ou consultez plusieurs des panels existants disponibles dans le commerce ici.


Fond

Les chromosomes, les structures génétiques d'une cellule, sont constitués d'acide nucléique désoxyribose (ADN) et des protéines et autres éléments qui protègent, régulent et conditionnent l'ADN. Les humains ont normalement 23 paires de chromosomes, dont la moitié est héritée de chaque parent. Au cours de la réplication cellulaire, les chromosomes sont parfois perdus ou gagnés, ou brisés et réarrangés. Les réarrangements varient en taille et en complexité, et peuvent être équilibrés, sans perte ni gain de matériel génétique, ou déséquilibrés.

Les réarrangements chromosomiques déséquilibrés qui sont présents à la conception ou qui se produisent pendant le développement fœtal ont des conséquences profondes pour le fœtus en développement, entraînant la mort du fœtus, des anomalies structurelles, des maladies génétiques ou une déficience intellectuelle.5 Des anomalies chromosomiques surviennent dans 43,8 pour 10 000 naissances qui survivent jusqu'à 20 ans. semaines de gestation ou plus.6 Les trisomies 21, 18 et 13 45, X et d'autres anomalies des chromosomes sexuels représentent la plupart des anomalies. En excluant celles-ci, la prévalence des anomalies les plus rares est de 7,4 pour 10 000 naissances.6 De petites duplications ou délétions pathologiques surviennent dans 1 des 270 grossesses.7 Les études examinant la prévalence des anomalies chromosomiques se sont concentrées sur la période prénatale,6 la prévalence à la naissance,8 ou la prévalence parmi les individus présentant des défauts structurels spécifiques9 ou des troubles du développement.10 Le nombre d'enfants ou d'adultes vivants présentant une anomalie chromosomique est inconnu. Bien que l'espérance de vie des personnes présentant une anomalie chromosomique puisse être considérablement raccourcie par des anomalies congénitales et d'autres conditions, la durée de vie des personnes atteintes a augmenté ces dernières années.

En 2010, l'International Standard Cytogenomic Array (ISCA) Consortium a publié une déclaration de consensus selon laquelle la puce à ADN chromosomique (également appelée génomique) devrait remplacer le caryotype à bande G en tant que test de premier niveau pour le diagnostic des personnes présentant des troubles du développement ou des anomalies congénitales. En 2013, l'American College of Medical Genetics (ACMG) a recommandé que les puces à ADN chromosomique remplacent le caryotype en bande G pour l'évaluation clinique des troubles du spectre autistique. Ces déclarations, combinées à la prévalence croissante de l'autisme, pourrait augmenter considérablement les commandes de puces à ADN génomiques. L'AG entraîne une augmentation du rendement diagnostique de l'AG par rapport au caryotype, ce qui sous-tend les déclarations de consensus de l'ISCA et de l'ACMG. Cependant, les circonstances dans lesquelles ces tests sont les plus utiles et leur contribution à la prise en charge médicale et éducative des enfants atteints ne sont pas claires.


WES vs WGS : pourquoi l'exome n'est pas toute l'histoire (et parfois quand c'est mieux)

Dans l'épisode de ce mois-ci, nous allons revenir un peu plus en profondeur sur un sujet qui a déjà été abordé dans cet espace, à savoir les différences entre une séquence complète du génome (WGS) et une séquence complète de l'exome (WES). En surface, les différences sont simples et explicites dans les noms. WGS fournit la séquence de l'ADN génomique (nucléaire) d'un échantillon, y compris toutes sortes de régions non codantes telles que les centromères, les télomères, de longues séquences répétitives d'ADN « poubelle » et diverses régions de contrôle non transcrites qui influencent l'activité de l'ADN réel. gènes. Pour un humain, un génome entier est d'environ 3,3 milliards de paires de bases, haploïde, soit 6,6 milliards de paires de bases pour capturer l'ensemble du complément diploïde par cellule. L'exome, en revanche, n'est que la collection d'ARN exprimés (y compris à la fois des ARNm codants et des ARN fonctionnels non codants qui peuvent être tout, des composants ribosomiques fonctionnels de l'ARNr aux ARNt essentiels pour l'expression des protéines, en passant par des éléments tels que les miARN importants pour le silençage génique et la régulation post-transcriptionnelle). L'exome humain a une taille totale d'environ 30 millions de paires de bases, soit seulement environ un pour cent du génome.

Le séquençage d'un génome ou d'un exome nécessite la collecte d'un « excédent » important de données, ou « profondeur de séquençage ». Ceci est fait pour deux raisons : l'une est d'améliorer la précision (une seule lecture peut déformer une paire de bases particulière, donc un consensus de plusieurs lectures sur le même endroit est plus précis) et l'autre est que de construire des lectures sur toute la longueur du chromosome à partir de les bits courts nécessitent un "pavage" ou un chevauchement entre les lectures afin que nous puissions générer de longues séquences contiguës. Étant donné que les technologies de séquençage de nouvelle génération (NGS) prédominantes produisent des longueurs de lecture individuelles beaucoup plus courtes que de nombreux transcrits d'ARN, le carrelage est autant une exigence pour WES que pour WGS. Dans l'ensemble, alors, bien qu'il y ait beaucoup de nuances dans lesquelles nous n'entrerons pas, alors qu'un WGS ou un WES nécessite que beaucoup de données soient générées et traitées par des pipelines bioinformatiques, un WES est en première approximation 30 fois moins de données qu'un WGS (vous êtes excusé de vous attendre à ce que cela soit 100 fois supérieur, mais WGS a tendance à être exécuté

100x, pour permettre la capture de variantes rares plus sur celle ci-dessous). De toute évidence, WES a un avantage immédiat sur WGS en ce sens qu'il est plus rapide et moins cher à obtenir et à analyser.

Nous pensons généralement à faire une certaine forme de NGS dans un contexte clinique comme un moyen d'essayer de découvrir la cause première d'une manifestation physique particulière - un phénotype. Nous ignorerons la réalité gênante selon laquelle certains comportements phénotypiques découlent de traits polygéniques complexes et supposerons pour simplifier que dans cet exemple hypothétique, il s'agit d'une simple cause mendélienne monogénique. Mis à part les facteurs de coût et de temps, quels sont les avantages et les inconvénients de l'utilisation d'une approche WGS ou WES pour résoudre ce problème ?

Surprise n°1 : pour une couverture complète des exons, WGS bat WES

Au sein des séquences codant pour les protéines, les mutations peuvent dans certains cas être connues comme pathogènes à partir d'autres exemples, ou elles peuvent être nouvelles mais d'un impact facilement apparent tel que des codons d'arrêt, des insertions/suppressions importantes ou des décalages de cadre. Des substitutions d'acides aminés encore moins facilement interprétables peuvent dans certains cas être examinées par rapport à des structures protéiques connues ou prédites par ordinateur avec une chance raisonnable de repérer des changements significativement perturbateurs (mettre une proline au milieu de cette hélice critique n'est probablement pas une bonne chose) ! Bien que vous puissiez penser que les mutations dans les régions codantes devraient être également observables dans les approches WES et WGS, il a été observé que ce n'est pas tout à fait vrai en particulier, les séquences de gènes riches en GC semblent capturées avec plus de précision par WGS que WES. WGS obtient également de meilleurs résultats en termes d'exhaustivité parmi les panels présélectionnés de gènes pertinents pour la maladie, où WES manquerait entre 0,42 % et 24,44 % des données exoniques capturées dans une stratégie WGS sans PCR. (Pour un examen plus approfondi de ces chiffres, voir par exemple [1]). Si votre objectif est une couverture complète, même juste des exons, alors WGS devance WES.

Des mutations significatives peuvent également se produire en dehors des exons, dans des éléments régulateurs tels que des promoteurs transcriptionnels, des amplificateurs et des suppresseurs, modifiant ainsi le niveau d'expression et/ou l'emplacement. De même, des mutations au sein des introns peuvent influencer la sélection du site d'épissage et conduire à une expression inappropriée d'isoformes variant d'épissage particuliers d'un gène qui est autrement exprimé à un niveau global approprié. Étant donné que ceux-ci, de par leur nature même, se produisent dans des sections non transcrites du génome (ou du moins ne sont pas conservés dans les transcrits matures), on pourrait s'attendre immédiatement à ce qu'ils soient capturés dans WGS et non dans WES. À proprement parler, c'est vrai, un ensemble de données WGS inclura toutes ces sortes de régions, mais un défi survient lorsque nous essayons d'interpréter. Comme avec les exons, dans certains cas, il existe des variations très spécifiques telles que les SNP (polymorphismes nucléotidiques simples) dans les régions non exoniques qui ont un impact phénotypique connu (ou son absence). Alors que les bases de données se remplissent de plus en plus d'exemples de génomes humains avec des corrélats cliniques, la bibliothèque de variations connues s'agrandit. Cependant, à l'heure actuelle, comparée à la taille du génome humain et à la fréquence à laquelle des variations par rapport aux génomes de référence sont observées, cette bibliothèque connue est petite et dans la majorité des cas, les variations constatées sont d'impact inconnu. Ceux-ci ont même leur propre nom « VUS » (variantes d'importance inconnue) et créent un certain nombre de maux de tête dans la pratique clinique, non seulement au niveau de l'interprétation, mais également en ce qui concerne les problèmes éthiques liés à leur divulgation. En particulier, si elles sont divulguées à des non-spécialistes, elles sont susceptibles de provoquer des malentendus (pour une discussion plus approfondie, voir par exemple [2]). Selon certaines estimations, chacun de nous se promène avec environ un demi-million de VUS dans ses génomes respectifs. Ainsi, alors que les données WGS capturent tout cela, nous ne savons souvent pas comment interpréter ce que nous avons.

Surprise n°2 : regardez vers les exons si vous voulez savoir ce qui s'est passé en dehors d'eux

Paradoxalement, la meilleure approche pour trouver des preuves d'une variation non exonique significative est probablement le WES. C'est vrai, nous devrions regarder les exons pour savoir ce qui s'est passé ailleurs. La clé ici est de se rappeler qu'un WES est généré à partir d'ADNc et comprend non seulement des séquences individuelles, mais également des fréquences d'observation relatives de produits géniques et même des variantes d'épissage particulières d'un seul gène. Si (et c'est une mise en garde critique) la bibliothèque d'ADNc utilisée pour WES provient de la population cellulaire d'intérêt, cela fournit un instantané non pas des séquences non exoniques réelles mais de leurs effets significatifs. Par exemple, dans le cas de mutations ayant un impact sur le niveau d'expression génétique net, le gène impacté représentera un niveau inférieur ou supérieur par rapport à celui attendu lorsqu'il est référencé à d'autres gènes domestiques dans l'échantillon. Lorsque la mutation a un impact sur quelque chose de plus nuancé, tel qu'un biais de site d'épissage dans un gène particulier, les niveaux relatifs d'isoformes géniques s'écarteront dans l'échantillon des rapports d'isoformes équivalents dans les échantillons de contrôle. Bien que cela ne nous donne aucune information sur la ou les mutations à l'origine de la cause réelle, cela ignore l'impact des variations vraiment insignifiantes que nous classerions autrement comme VUS et que nous ne laisserions pas plus sages.

Alors, quoi de mieux, WGS ou WES ?

La réponse à cette question dépend de ce que vous recherchez et des ressources disponibles en termes de temps, de coût et d'outils bioinformatiques. WES est devenu très populaire dès le début et il reste une stratégie ciblée et rentable pour examiner ce qui est susceptible d'être l'ensemble de données génomiques le plus dense en informations à partir d'un échantillon. Gardez à l'esprit le commentaire ci-dessus, cependant, que les populations d'ADNc et leurs ensembles de données WES dérivés sont spécifiques aux tissus dans une certaine mesure. En plus de cela, ils ont démontré des préjugés contre la représentation de certains types de séquences et peuvent manquer de l'exhaustivité d'un WGS. En comparaison, le WGS sans PCR nécessite plus de coûts et d'efforts, mais est plus complet dans sa couverture et est généralisable à l'ensemble de l'organisme (nous prétendrons que cet espace n'a pas été récemment consacré au microchimérisme somatique comme exception à cela). Si à un moment donné dans le futur, nous avons beaucoup plus de données telles que VUS sont une chose du passé, alors WGS sera probablement le « meilleur » choix. Cependant, avant que cela ne se produise, et à mesure que les coûts de la technologie NGS continuent de baisser et que la facilité d'utilisation augmente, nous pouvons atteindre une situation où l'image génomique la plus complète et la plus interprétable est obtenue en capturant à la fois un WGS et un WES apparié pour les tissus. Chacun fournit un aperçu légèrement différent du génome et en réalité les deux formes de données sont complémentaires.


Séquençage du génome entier ou de l'exome : un aperçu individuel

Se concentrer sur des parties plutôt que sur l'ensemble, lorsqu'il s'agit de séquençage du génome, pourrait être extrêmement utile, selon des recherches dans la revue en libre accès de BioMed Central Médecine du génome. La recherche compare plusieurs technologies de séquençage chez le même individu atteint de la maladie de Charcot-Marie-Tooth (CMT) et montre que le séquençage des régions codantes seules à une profondeur de couverture élevée peut identifier la variation génétique à l'origine de cette maladie et a également permis de résoudre les précédents ambiguïtés.

Le séquençage de nouvelle génération pour comprendre la variation de l'ADN humain et les troubles génétiques progresse à pas de géant. Le séquençage du génome entier lit tout l'ADN d'un individu, tandis que le séquençage de l'exome ne capture que les parties de l'ADN qui codent pour les protéines. Le séquençage de l'exome est plus rapide et moins cher, mais des inquiétudes ont déjà été soulevées quant au fait qu'il manque des informations importantes.

Une équipe du Baylor College of Medicine dirigée par le professeur James Lupski et le professeur Richard Gibbs a comparé plusieurs technologies différentes de séquençage de l'exome et du génome entier sur l'ADN de la même personne atteinte de CMT. Le professeur Jim Lupski a expliqué : « Les deux méthodes ont permis de trouver les mêmes 12 variantes qui affectent la réponse cellulaire à des médicaments spécifiques tels que les bêtabloquants, la warfarine et le paclitaxel, un médicament anticancéreux, et d'identifier de nouvelles mutations associées à la CMT dans SH3TC2 qui codent pour un protéine ayant un rôle dans la myélinisation des nerfs périphériques."

Le séquençage de l'exome avait moins de faux positifs et une plus grande sensibilité en raison de la couverture plus élevée obtenue lors de la focalisation uniquement dans une petite fraction du génome. Par conséquent, il a pu identifier correctement les nucléotides qui étaient ambigus lors de l'utilisation du séquençage du génome entier à une couverture inférieure, et ainsi clarifier s'ils étaient associés ou non à la CMT.

Le professeur Richard Gibbs a commenté : « La couverture plus élevée offerte en se concentrant sur l'exome à environ 120 fois pour les exomes cliniques permet une plus grande précision du séquençage de l'exome, ce qui en fait une approche supérieure, plutôt qu'un raccourci, pour trouver quelles personnes pourraient répondre à une thérapie particulière ou pour définir qui a une maladie spécifique.


Résultats

La recherche dans la base de données a identifié 1 277 publications, dont 302 étaient des doublons (Figure 1). Une fois les titres et les résumés sélectionnés et les publications en texte intégral évaluées pour leur éligibilité, 14 publications répondant aux critères d'inclusion ont été identifiées. Un examen des références bibliographiques des publications récupérées et des publications d'auteurs reconnus dans ce domaine a identifié 22 publications pertinentes supplémentaires (dont 7 ont été identifiées après juillet 2016, date de fin prévue pour le dépistage de la littérature 18,19,20,21). Au total, 36 publications pertinentes ont été identifiées.

Résultats de la recherche documentaire.

Caractéristiques de l'étude

Le tableau 2 résume les caractéristiques de ces 36 publications. Des descriptions détaillées sont fournies dans l'annexe supplémentaire S3. Les publications ont étudié l'utilisation de WES et WGS dans une variété de conditions avec un fond génétique. Les affections les plus courantes étaient les troubles neurologiques ou neurodéveloppementaux (7 publications), avec 13 (36 %) publications étudiant le WES et le WGS exclusivement chez les enfants ou les nouveau-nés. La taille de l'échantillon de l'étude variait d'un seul enfant à une cohorte de 2 000 patients.

Les études rapportées dans les neuf publications suivantes (22 %) n'avaient pas de population de patients. Bennette et al. 22 ont utilisé un modèle d'analyse décisionnelle pour évaluer la rentabilité du retour des découvertes fortuites de WES et WGS aux États-Unis. Buchanan-Hughes et al. 23 ont construit un arbre de décision pour calculer l'utilité du coût du WGS bactérien dans la voie diagnostique des infections des voies urinaires. Chrystoja et Diamandis 24 ont présenté une discussion sur les défis et les opportunités associés à l'utilisation du WGS comme test de diagnostic. Le rapport de la Fondation pour la génomique et la santé de la population 25 a décrit les coûts du WES pour le cancer colorectal dans trois laboratoires du National Health Service du Royaume-Uni. Plöthner et al. 26 ont étudié les coûts associés à l'exécution du WGS dans la pratique clinique allemande. Sabatini et al. 27 ont mené une étude ascendante sur les coûts de l'EMTE au Canada et ont comparé les résultats avec les coûts de la voie clinique traditionnelle pour le diagnostic des troubles neurodéveloppementaux, en utilisant des modèles d'impact sur les coûts du payeur. Van Nimwegen 28 constructed a decision model to examine the cost-effectiveness of WES in clinical practice in the Netherlands. Finally, Tsiplova et al. 20,21 calculated the cost-effectiveness of WES and WGS compared with chromosomal microarray analysis (CMA) in three hypothetical testing scenarios.

Twenty-one economic evaluations were identified, of which 8 were full economic evaluations 18,19,20,21,22,23,28,29,30 and 13 were partial economic evaluations. 3,31,32,33,34,35,36,37,38,39,40,41,42 Seven studies presented data on the costs of WES or WGS testing pathways, 24,25,26,27,43,44,45 and eight studies presented data on clinically relevant outcome measures for these tests. 5,6,8,9,10,46,47,48 Of the eight full economic evaluations, two were CUAs 22,23 and six were CEAs, published between 2014 and 2017 in Australia (2), the United States (1), the UK (1), the Netherlands (1), and Canada (1). 18,19,20,21,28,29,30 Of these publications, the study by Soden et al. 29 did not directly report WES costs but estimated the cost-effectiveness threshold for WES in pediatric neurodevelopmental disorders by calculating the cost of the current diagnostic pathway.

All 13 partial economic evaluations were cost-consequence analyses. These studies were published between 2013 and 2016 in the Netherlands (4), Australia (3), Canada (2), France (1), the United States (2) and the United Kingdom (1). Eleven of these publications investigated WES, with the study by Pankhurst et al. 42 evaluating bacterial WGS and the study by Shashi et al. 3 evaluating several potential NGS approaches. While all 13 publications reported cost estimates for WES or WGS, only 3 stated the methods and sources underlying these estimates. 35,37,42

Of the seven studies that presented data on the costs of WES or WGS testing pathways, four evaluated WGS. Chrystoja and Diamandis 24 reviewed the potential of WGS and summarized cost data extracted from previously published scientific studies and commercial sources. Dewey et al. 43 estimated the costs of WGS in the United States as well as the costs associated with curation and clinical follow-up. Weymann et al. 45 estimated the costs of using WGS to inform treatment decisions in patients with advanced cancers. Towne et al. 44 estimated the cost of using WES to achieve a diagnosis in rare presentations in a pediatric population. The studies by the Foundation for Genomics and Population Health, 25 Sabatini et al., 27 and Plöthner et al. 26 have been described previously.

Eight studies, published between 2011 and 2016, presented data on clinically relevant outcome measures for WES and WGS. Seven of these studies investigated WES 5,6,8,9,10,46,47 the eighth evaluated WGS. 48 Four publications used the traditional care pathway in the investigated condition as a comparator. 6,10,46,48 Three publications were retrospective analyses 6,47,48 and three were diagnostic studies, estimating the diagnostic yield of WES in a variety of conditions. 5,8,9 The final two studies were case studies on single probands and families. 10,46

Twenty-four (67%) of the publications that met the inclusion criteria focused on WES, with five (14%) focusing on WGS, five (14%) focusing on both WGS and WES, and two (6%) evaluating bacterial WGS. The most common study setting was the United States (36% of publications). The earliest two studies were published in 2011, with all other studies published between 2013 and 2017.

WES and WGS costs

Table 3 summarizes the cost estimates for NGS approaches, with detailed information provided in Supplementary Appendix S4. Twenty-nine studies reported cost estimates, of which 18 reported costs for WES. Estimates ranged from £382 ($555) 32 to £3,592 ($5,169) 34,38 for a single WES test. The highest estimate for a single test (£3,592) was based on commercial prices. The highest estimate of the actual costs of a single WES test (i.e. not commercial prices) was £1,808 ($2,602). 37 Cost estimates for a trio ranged from £2,658 ($3,825) 44 to £6,466 ($9,304). 38 Thirteen publications stated that costs were estimated within the study nine of these publications reported their costing approach. 19,20,21,26,27,28,36,37,45 Many publications did not state which components were included in the cost estimate. The costs for reagents ranged from £291 ($420) 35 to £1,171 ($1,685). 31

Cost estimates varied little over time. The lowest estimate for a single WES test was £736 ($1,060) 44 in 2013 and £736 ($1,070) 28 in 2017. In terms of country-level costs, the lowest estimate (£382 $555) 32 was reported in an Australian study from 2015, and the highest estimate (£3,592 $5,169) 36,38 was reported in two Canadian studies from 2014. There were no regional differences: the lowest cost estimates in North America (£736 $1,060) 44 and the rest of the world (£382 $555) 32 were similar, but far less with the higher cost estimates (£3,592 $5,169 in North America, 36,38 £3,401 $4,907 in the rest of the world). 40,41

Six studies estimated the cost of WGS, four of which used data from commercial sources. 24,26,28,43 Cost estimates ranged from £1,312 ($1,906) for sequencing using the HiSeq X in Germany 26 to £17,243 ($24,810) for an unspecified platform in Canada. 24 Four studies used a transparent bottom-up approach to estimate the cost of WGS. 20,21,26,28,45 There was limited evidence of a reduction in the cost of WGS over time, with the lowest estimate declining from £10,497 ($15,146) 43 in 2013 to £1,312 ($1,906) 26 in 2017. However, this is based on a small sample. The two cost estimates for bacterial WGS were considerably lower than those for WES or WGS in humans.

Finally, of the 16 studies that calculated test costs rather than applying an assumed figure or using a commercial price, only 10 described the cost calculation in a transparent manner.

WES and WGS outcomes

A variety of outcomes were assessed in the publications that met the inclusion criteria, including successful diagnoses, diagnostic yield, sensitivity and specificity, quality-adjusted life years (QALYs), time to diagnosis, change in clinical management, acute clinical usefulness, mortality/survival, parent satisfaction, frequencies of disease subtypes, mode of inheritance, spectrum of genetic events, reporting of incidental findings, target capture, and prediction of bacterium species and drug susceptibility. Diagnostic yield was the most common outcome measure (18 publications). Table 4 summarizes diagnostic yield estimates by sequencing approach, with detailed information provided in Supplementary Appendix S5. The lowest diagnostic yield for WES (3%) was estimated in a patient group with colorectal cancer. 37 The highest rate for WES (79%) was reported for individuals with childhood-onset muscle disorders. 18 Around a third of the included publications investigated WES or WGS in a population group that was difficult to diagnose.

WES and WGS cost-effectiveness

Eight studies estimated the cost-effectiveness of WES or WGS. Sagoo et al. 30 estimated the cost-effectiveness of WES compared with usual testing practice (genetic tests and disease gene panel tests) in a variety of disease contexts. When WES was introduced later in the testing pathway, the incremental cost per additional positive diagnosis was £3,213 ($4,670). When WES was used as a near first-line test the incremental cost per additional positive diagnosis was £2,230 ($3,242).

Van Nimwegen 28 compared the costs and outcomes associated with WES (using the HiSeq 4000) with those of conventional diagnosis for pediatric neurological disorders (which includes magnetic resonance imaging scans, electroencephalography, and muscle biopsies). In the author’s first analysis, WES was treated as a last-resort test, with an incremental cost per additional diagnosis of £8,319 ($12,092). The second analysis treated WES as a first-line test, and in many plausible scenarios this resulted in cost savings.

Soden et al. 29 estimated that WES would be cost-effective in pediatric neurodevelopmental disorders, compared with existing nongenomic investigative approaches (including laboratory tests, radiologic procedures, and electromyograms) on a cost-per-diagnosis basis if the cost of WES was no more than £2,123 ($3,063) per individual.

Schofield et al. 18 reported that WES offered a cost saving per diagnosis of £6,483 ($9,342) compared with traditional investigations (muscle biopsy, histological and biochemical analyses, Sanger sequencing) for the diagnosis of pediatric muscle diseases.

Stark et al. 19 examined the cost-effectiveness of three scenarios for implementing WES as a routine clinical test for infants with suspected monogenic disorders. Integrating WES after standard investigations (including biochemical investigations, imaging, and neurophysiological studies) cost £3,830 ($5,518) per additional diagnosis, replacing a subset of existing investigations with WES cost £1,238 ($1,784) per additional diagnosis, and implementing WES as a first-line test to replace most investigations saved £1,030 ($1,484) per additional diagnosis.

Tsiplova et al. 20,21 evaluated the cost-effectiveness of strategies involving WES and WGS compared with CMA in autism spectrum disorder. Adding WES to CMA cost £13,912 ($20,046) per additional diagnosis, whereas implementing WGS instead of CMA cost £32,219 ($46,424) per additional diagnosis using a HiSeq 2500 sequencer, and £14,219 ($20,488) using a HiSeq X sequencer. Implementing WGS compared with a WES-plus-CMA approach cost £106,590 ($153,587) per additional diagnosis using a HiSeq 2500 sequencer, and £15,464 ($22,283) using a HiSeq X sequencer.

Buchanan-Hughes et al. 23 investigated the cost-effectiveness of bacterial WGS to guide targeted antibiotic selection in urinary tract infections, finding that bacterial WGS was more expensive than methods employed in current clinical practice, with poorer health outcomes.

Finally, Bennette et al. 22 estimated the cost-effectiveness of generating information on incidental findings using genomic sequencing. The cost per QALY gained for cardiomyopathy patients was estimated to be £32,187 ($46,313), for colorectal cancer patients it was £82,623 ($118,883), and for healthy individuals it was £42,102 ($60,578). Generating information on incidental findings for cardiomyopathy patients and healthy individuals was therefore cost-effective, compared with a threshold of $100,000 per QALY gained.


23andMe and AncestryDNA Genotyping vs Whole Genome Sequencing

If you’ve been genotyped by 23andMe, AncestryDNA, MyHeritage, Family Tree DNA (FTDNA), or Living DNA you may believe you had all of your DNA sequenced. What if you learned that 23andMe only genotypes around 0.02% of your DNA? Whole genome sequencing gives you over 4,000 times more data and over 900 times more known genetic variants. Yes, you’ve read that right — over four thousand times more data!

Surprised? Tu n'es pas seul. You can now get affordable Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) from several providers. You can sequence 100% of your DNA with Whole Genome Sequencing.

The Difference Between Genotyping and Whole Genome Sequencing

Comparing consumer genotyping data to Whole Genome Sequencing data is like comparing a mountain to a small mound. Or for a better perspective it’s like comparing a 1/4000 scale Star Wars Imperial Star Destroyer to a actual Imperial Star Destroyer!

Imperial Star Destroyer 1/4000 scale (source: YouTube)

Don’t get me wrong, a 1/4000 scale Imperial Star Destroyer is pretty cool. But do you really think it can take on a réelStar Destroyer. I think not! Jokes aside, you honestly can’t compare genotyping to sequencing. It’s like comparing apples to oranges.

Genotyping is like picking specific words from a page and sequencing is like reading and storing the entire book. With genotyping, if you want to grab a specific word that you did not have genotyped out of the book, you are out of luck. You have to be genotyped again looking for that specific word. In more scientific terms, genotyping gives you selected Single Nucleotide Polymorphisms (SNPs) and Insertion/Deletion variants (Indels). Whole Genome Sequencing gives you the SNPs, Indels, and all other DNA.

I borrowed this comparison from Helix. Perhaps they state this concept better than I did in this video:

Back to the Book Analogy

When sequencing, we use some pretty strange techniques. We basically take your book (your DNA), shred it into tiny fragments, and then xerox it 30 times (for 30x sequencing). These fragments are usually around 100-250 letters long (scientifically referred to as base pairs). So it’s usually shredded into somewhere between 12 million and 30 million unique parts depending on the type of sequencing. Counting the xeroxed copies, there are around 360 million to 900 million fragments.

After we are done shredding the book and xeroxing the shreds, we take all these shreds and figure out where they belong again to the best of our ability. We reference another book to do this. This book has slight differences than our book. But the purpose of this process it determine what the difference is between our book and the reference book. And we can almost put this book completely back together even with the slight differences. About 5% of the book is too difficult to assemble. But it’s the best we can currently do!

After we finish assembling the book, we store all the pieces with a map and index of exactly where they belong. We call this book, “My Genome.” We don’t usually discard the pieces we couldn’t map. Instead, we store them in an envelope called “unmapped reads.” These unmapped reads may belong to pieces of the book that couldn’t be assembled. Or it may be DNA of things that contaminated the book — Viruses, Bacteria, Archae, Fungi and Parasites. Gross! There are a lot of germs on books!

In technical jargon, the shredded book is random readings of your DNA stored in compressed computer files called a FASTQ files. A high end computer or cloud computing would then take these random FASTQ reads in these files and create a map of where they belong. The computer stores the reads, the map, and an index into a compressed binary file called a BAM (Binary Alignment Map) file. These files can vary in size, but for a whole genome, it’s not uncommon that the FASTQ and BAM files are around 50-120 gigabytes each and about 100-240 gigabytes combined.

But this book is very large in size and is hard to carry around. And we are mostly interested in the differences between “My Genome” and the reference book. So we scan the assembled version of this book and create notes of where all the differences are. We also reference the xeroxed copies to determine not only how many times sentences of the book was read, but how accurately we read it. Remember, when you xerox things a lot of times, parts will inevitably come out blurry and it can be hard to read each letter or word. If the accuracy is good, we mark things as pass. If we can’t tell exactly what the book says, we mark why it didn’t pass. We then have a notebook filled with everything that’s different between “My Genome” and the reference book and whether or not it passed our accuracy check.

Going technical again, what we are doing is generating what’s called a VCF (Variant Call Format) file from the BAM file. The VCF file tells us where our genome didn’t match the reference genome. In simpler words, this helps show us where are genetic polymorphisms and mutations are. This file is compressed to save disk space and make it more portable. VCF files are typically between 150-300 megabytes for a Whole Genome Sequence. But they can be a little bigger or smaller than this depending on the tools used to make them.

Summary of What We Just Learned

Wow, that was a lot. But in summary:

  1. Consumer genotyping gives you about 0.02% of your DNA while Whole Genome Sequencing gives you roughly 4000x that amount.
  2. Consumer genotyping represents a tiny fraction of your DNA while Whole Genome Sequences represents close to 100% of your DNA.
  3. For 30x sequencing, random reads of your DNA are read 30x on average and stored in a files called FASTQ files. Since these reads are random, they are not mapped to you or anything.
  4. We use intensive computing (usually cloud computing) to map these FASTQ files to a BAM file. This BAM file contains all the data in our FASTQ files along with a map and an index of where the reads align to the reference genome.
  5. From this BAM file, we make a more compact file called a VCF file that tells us exactly where we differ from the reference genome. These are our variants and mutations. VCF files contain 1 letter differences from the reference genome (SNPs) or insertions or deletions of several letters (Indels).

If you are still confused, I recommend watching this two minute video titled What is Genomic Sequencing? from Mayo Clinic:

I hope that helped explain the difference between genotyping and sequencing and explained the concepts of sequencing without breaking your brain. I’m pretty sure I broke my brain a few times trying to write this, so don’t feel bad if your brain feels broken too.

If you have any feedback or think I got a concept wrong, please let me know in the comments.


Informations sur l'auteur

Affiliations

German Center for Neurodegenerative Diseases (DZNE), Otfried-Müller-Str. 23, Tübingen, 72076, Germany

Iris E. Jansen, Sasja Heetveld, Marie C. Lechler, Javier Simon-Sanchez, Melissa Castillo-Lizardo, Patrizia Rizzu, Cornelis Blauwendraat, Della C. David, Shushant Jain & Peter Heutink

Department of Clinical Genetics, VU University Medical Center, Amsterdam, 1081HZ, The Netherlands

Iris E. Jansen & Peter Heutink

Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA

Graduate School of Cellular & Molecular Neuroscience, Tübingen, 72074, Germany

European Research Institute for the Biology of Aging, University of Groningen, University Medical Centre Groningen, Groningen, 9700AD, The Netherlands

Helen Michels, Renée I. Seinstra & Ellen A. Nollen

Department of Clinical Neuroscience, UCL Institute of Neurology, London, UK

Steven J. Lubbe & Huw R. Morris

Northwestern University Feinberg School of Medicine, Ken and Ruth Davee Department of Neurology, Chicago, IL, USA

Inserm U1127, CNRS UMR7225, Sorbonne Universités, UPMC Univ Paris 06, UMR_S1127, Institut du Cerveau et de la Moelle épinière, Paris, France

Valérie Drouet, Suzanne Lesage & Alexis Brice

Institute of Psychological Medicine and Clinical Neurosciences, MRC Centre for Neuropsychiatric Genetics and Genomics, Cardiff University, Cardiff, UK

Laboratory of Neurogenetics, National Institute on Aging, Bethesda, MD, USA

J. Raphael Gibbs, Mike A. Nalls & Andrew B. Singleton

Department of Molecular Neuroscience, UCL Institute of Neurology, London, UK

Mina Ryten, Juan A. Botia & Jana Vandrovcova

Department of Medical & Molecular Genetics, King’s College London, London, UK

Hertie Institute for Clinical Brain Research, University of Tübingen, Tübingen, Germany

Javier Simon-Sanchez & Peter Heutink

Department of Neurology, Baylor College of Medicine, Houston, TX, USA

Amit K. Chouhan, Yarong Li, Puja Yogi & Joshua M. Shulman

Genetic Epidemiology Unit, Department of Epidemiology, Erasmus MC, Rotterdam, The Netherlands

Najaf Amin & Cornelia M. van Duijn

Assistance Publique Hôpitaux de Paris, Hôpital de la Salpêtrière, Département de Génétique et Cytogénétique, Paris, France

Department of Neuroscience and Program in Developmental Biology, Baylor College of Medicine, Houston, TX, USA

Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, 1250 Moursund St., N.1150, Houston, TX, 77030, USA


Voir la vidéo: Le séquençage du génome (Décembre 2021).