Informations

Biosynthèse des caroténoïdes chez la levure


La levure en herbe Sacchromyces cerevisiae produit-elle une quantité importante de caroténoïdes ? Quelqu'un a-t-il estimé le rapport de flux entrant dans les branches 1. Synthèse du cholestérol (via le squalène) 2. Coenzyme Q6 et 3. Dolichols Glycoprotéine et autres à partir du point de branchement du diphosphate de farnésyle.

Voici le chemin du kegg

http://www.genome.jp/kegg-bin/show_pathway?map00900 J'ai également un chemin formaté mais je n'ai pas pu le télécharger.


L'enzyme phytoène synthase est la première étape engagée dans la biosynthèse des caroténoïdes. Saccharomyces cerevisiae n'a pas cette enzyme, ni le reste de la voie pertinente. D'autres levures telles que Rhodotorula spp et Phaffia rhodozyma peut fabriquer des caroténoïdes.

Cependant, la biosynthèse des caroténoïdes a été conçue pour S. cerevisiae.


Phaffia Rhodozyma

Phaffia rhodozyma est une levure fermentative productrice de caroténoïdes du Deuteromycotina (Blastomycetes). Sa capacité à synthétiser des caroténoïdes, la composition en bases de son ADN, certaines propriétés métaboliques telles que la capacité d'utiliser l'urée, la structure de la paroi cellulaire et le mode de formation des bourgeons, et la nature des polysaccharides qui composent la capsule indiquent une origine basidiomycète ( Miller et al., 1976 ). Les cellules végétatives sont ellipsoïdales et peuvent apparaître seules, en paires et parfois en chaînes courtes. Le vrai mycélium est absent, mais un pseudomycélium rudimentaire peut être présent. Phaffia rhodozyma peut produire des chlamydospores et former une pellicule sur un milieu liquide ( Miller, 1984 ). Phaffia rhodozyma a été isolé au début des années 1970 par Phaff et al. (1972) à partir d'exsudats d'arbres à feuilles caduques dans les régions montagneuses du Japon et de l'Alaska. Initialement désigné Rhodozyma montanae, il a ensuite été renommé Phaffia rhodozyma, d'après son découvreur Herman Jan Pfaff ( Miller et al., 1976 ). Le genre Phaffia n'a qu'une seule espèce, dans laquelle les 10 souches isolées par Phaff et al. (1972) ont été incorporés. Les tentatives d'accouplement de ces souches dans l'espoir d'observer la formation ultérieure de mycélium dicaryotique et de téliospores n'ont jamais abouti. Le type de souche est UCD (FS&T) 67-210 (= ATCC 24202 = CBS 5905).

Phaffia rhodozyma diffère de façon frappante des autres levures pigmentées de deux manières : elle fermente le glucose et d'autres sucres, et synthétise l'astaxanthine comme principal caroténoïde. Autres levures pigmentées du genre Cryptocoque, Rhodotorule, Rhodosporidium, Sporidiobole et Sporobolomyces sont strictement aérobies et synthétisent le β-carotène, le γ-carotène, le torulene ou la torularhodine comme pigment principal ( Simpson et al., 1971 ).


Résumé

Les opioïdes sont les principaux médicaments utilisés en médecine occidentale pour la gestion de la douleur et les soins palliatifs. La culture du pavot à opium reste la seule source de ces médicaments essentiels, malgré les diverses demandes du marché et l'incertitude des rendements des cultures due aux conditions météorologiques, au changement climatique et aux ravageurs. Nous avons conçu de la levure pour produire les composés opioïdes sélectionnés, la thébaïne et l'hydrocodone à partir de sucre. Tous les travaux ont été effectués dans un laboratoire autorisé et sécurisé pour le travail avec des substances contrôlées. Nous avons combiné la découverte d'enzymes, l'ingénierie enzymatique et l'optimisation des voies et des souches pour réaliser la biosynthèse complète des opiacés dans la levure. Les souches de biosynthèse des opioïdes résultantes nécessitaient l'expression des activités enzymatiques 21 (thébaïne) et 23 (hydrocodone) des plantes, des mammifères, des bactéries et de la levure elle-même. Il s'agit d'une preuve de principe, et des obstacles majeurs subsistent avant que l'optimisation et la mise à l'échelle puissent être réalisées. Des discussions ouvertes sur les options pour régir cette technologie sont également nécessaires afin de réaliser de manière responsable des approvisionnements alternatifs pour ces composés médicalement pertinents.

Les opioïdes sont une classe importante de médicaments qui comprennent la morphine analgésique et la codéine antitussive. L'Organisation mondiale de la santé (OMS) classe ces composés parmi les médicaments essentiels en raison de leur utilité dans le traitement de la douleur sévère, la gestion de la douleur et les soins palliatifs (1). Dans le monde en développement, il y a des pénuries d'analgésiques, l'OMS a estimé que 5,5 milliards de personnes ont « un accès faible ou inexistant au traitement pour la douleur modérée ou sévère » (2).

Tous les opiacés naturels (par exemple, la morphine et la codéine) et les opioïdes semi-synthétiques (par exemple, l'oxycodone, l'hydrocodone et l'hydromorphone) sont actuellement dérivés du pavot à opium (Papaver somniferum). Environ 100 000 ha de pavot à opium sont cultivés chaque année pour produire de la paille de pavot contenant plus de 800 tonnes d'opiacés, principalement de la morphine et de la thébaïne, pour répondre à la demande médicale et scientifique licite (3). La majorité de la morphine et de la thébaïne dérivées du pavot est chimiquement convertie en composés de plus grande valeur, notamment la codéine, l'oxycodone et l'hydrocodone. La culture industrielle du pavot est sensible aux facteurs environnementaux tels que les parasites, les maladies et le climat, qui peuvent introduire de l'instabilité et de la variabilité dans cette chaîne d'approvisionnement géographiquement concentrée, entraînant une pression pour diversifier l'approvisionnement (4). Malgré la diversité des demandes du marché et l'augmentation des risques d'approvisionnement, la culture du pavot reste la seule source d'opioïdes, en partie parce que la synthèse chimique de ces molécules complexes n'est pas compétitive sur le plan commercial. Environ 30 synthèses chimiques de morphine et de ses dérivés ont été rapportées (5), mais aucune n'est envisageable pour une production à grande échelle.

Un processus de fabrication à base microbienne pour les opioïdes ou les précurseurs d'opioïdes, qui font partie de la classe plus large des alcaloïdes benzylisoquinoléines (BIA), a le potentiel de relever de nombreux défis associés à la chaîne d'approvisionnement à base de pavot. Culture industrielle de micro-organismes, comme la levure de boulanger Saccharomyces cerevisiae, se produit sur plusieurs jours, alors que les coquelicots sont des annuelles. De plus, étant donné que les microbes sont cultivés dans des cuves de fermentation fermées, le processus de production n'est pas sensible aux facteurs environnementaux externes et pourrait fournir une plus grande cohérence dans la composition du produit et les profils d'impuretés entre les lots.

Au cours des dernières années, les chercheurs ont modifié la levure pour produire une variété de produits naturels à base de plantes (6), notamment l'acide artémisinique, un précurseur de l'artémisinine, un médicament antipaludique (7). La production semi-synthétique d'artémisinine a maintenant atteint le marché, répondant jusqu'à un tiers des besoins mondiaux (8, 9). La production d'acide artémisinique à base de levure a nécessité l'introduction de trois à six gènes végétaux hétérologues et de nombreuses modifications génétiques pour augmenter la productivité (7, 9). Bien que les progrès de la biologie synthétique aient augmenté la complexité des voies végétales qui peuvent être reconstruites (6), tous les efforts pour fabriquer de la levure pour produire des BIA en aval de (S)-réticuline, y compris les morphinanes, se sont appuyés sur un approvisionnement externe en précurseurs BIA (1015). Escherichia coli (16) et, très récemment, la levure (17, 18) ont été conçus pour produire de novo des intermédiaires BIA précoces, ces réalisations suggèrent que la levure pourrait être capable de synthétiser des opioïdes à partir de sources simples de carbone et d'azote. Nous et d'autres avons conçu la première partie de la voie de biosynthèse, de la tyrosine à (S)-réticuline (17, 18). Séparément, nous avons conçu une deuxième partie de la voie, de la thébaïne à la morphine (13) d'autres ont ensuite conçu un chemin à partir de (R)-réticuline en codéine (15). Cependant, l'expression fonctionnelle des plus de 20 gènes hétérologues requis pour la biosynthèse complète de ces molécules complexes a été difficile en raison des diminutions de titre observées à chaque étape enzymatique supplémentaire. En outre, l'enzyme clé qui épimérise le (S)-benzylisoquinoléine échafaudage au (R)-énantiomère, qui est le précurseur biosynthétique des échafaudages promorphinan et morphinan, est resté inconnu même après des décennies d'étude jusqu'à récemment identifié par deux groupes (19, 20) et par notre équipe, comme décrit ci-dessous.

Il y a dix ans, lorsque nous avons commencé à travailler pour réaliser la biosynthèse totale des opioïdes dans la levure, nous étions motivés par les nombreux avantages prévisibles tout en étant conscients des impacts négatifs potentiels. Plus précisément, nous étions et restons préoccupés par le fait qu'un approvisionnement en opioïdes à base de levure pourrait contribuer à l'abus d'opioïdes (21, 22). Ainsi, avant de démarrer ce projet, nous avons demandé et obtenu l'autorisation de le mener via l'enregistrement de recherche institutionnelle de l'Université de Stanford auprès de la Drug Enforcement Agency (DEA) des États-Unis. Obtention de l'autorisation requise (i) vérification des antécédents pour les chercheurs manipulant des composés de l'annexe II ou des souches de levure capables de fabriquer de tels composés (ii) protocoles détaillés limitant les volumes de fermentation et les concentrations de composés et comprenant des dispositions pour la culture et la destruction et l'élimination des produits immédiatement après les expériences (iii) augmenté confinement physique des souches et des composés contrôlés (iv) une sécurité accrue du laboratoire et (v) une gestion et des rapports explicites. Ensemble, ces exigences réduisent le risque que des composés ou des souches générés dans notre recherche permettent directement aux individus d'abuser d'opioïdes.

Nous avons d'abord construit une souche de levure pour produire (S)-réticuline, un intermédiaire biosynthétique clé pour de nombreux BIA en aval, y compris les morphinanes. Cette souche a été construite avec une nouvelle conception génétique modulaire qui incorporait des modifications conçues pour détourner un plus grand flux de carbone à travers la tyrosine vers (S)-réticuline. La voie de biosynthèse de la réticuline a été divisée en quatre modules génétiques qui contiennent les séquences codantes pour 17 enzymes biosynthétiques (figure 1A, figures S1 et S2 et tableau S1). Nous avons sélectionné des régions chromosomiques à partir desquelles nous n'attendions aucun défaut de croissance et une expression active comme loci d'intégration (2325). Un module de surproduction précurseur (I) conçu pour augmenter l'accumulation de l -tyrosine et de 4-hydroxyphénylacétaldéhyde (4-HPAA) a codé la surexpression de trois ou quatre protéines de levure - des mutants de 3-désoxy- d -arabeL'acide -2-heptulosonique 7-phosphate (DAHP) synthase et la chorismate mutase (Aro4p Q166K , Aro7p T226I ) qui sont moins inhibées par la l -tyrosine, et la transcétolase (Tkl1p) en plus, la phénylpyruvate décarboxylase (Aro10p) a été incluse dans une deuxième version de ce module (fig. S2). Une tétrahydrobioptérine (BH4) module (II) conçu pour synthétiser et recycler ce cofacteur redox mammifère codant pour l'expression de quatre protéines de Rattus norvegicus: sépiaptérine réductase (SepR), 6-pyruvoyl tétrahydrobioptérine synthase (PTPS), quinonoïde dihydroptéridine réductase (QDHPR) et ptérine carbinolamine déshydratase (PCD). Un (S)-norcoclaurine module (III) conçu pour synthétiser la première molécule du squelette BIA codant pour l'expression de quatre protéines : un mutant de la tyrosine hydroxylase (mutations TyrH WR R37E, R38E, W166Y) moins inhibé par la l-tyrosine et les catécholamines, de R. norvegicus la BH4 l'enzyme de récupération dihydrofolate réductase (DHFR), également à partir de R. norvegicus DOPA décarboxylase (DoDC) de la bactérie Pseudomonas putida et la norcoclaurine synthase (NCS) de la plante Coptis japonica. Un (S)-module de réticuline (IV) conçu pour synthétiser la molécule clé de branche de BIA codée l'expression de cinq protéines végétales, quatre de P. somniferum—norcoclaurine 6-O-méthyltransférase (6OMT), coclaurine-N-méthyltransférase (CNMT), 4′-O-méthyltransférase (4′OMT) et cytochrome P450 réductase (CPR)—ainsi que N-méthylcoclaurine hydroxylase (NMCH) de Eschscholzia californica. Les variants enzymatiques ont été sélectionnés sur la base des activités examinées dans la levure modifiée (11, 18) et a incorporé l'ajout de plusieurs nouvelles activités (c'est-à-dire Aro10p, DHFR) pour augmenter le flux vers la biosynthèse de la réticuline.

(UNE) Schéma biosynthétique pour la production de thébaïne et d'hydrocodone à partir de sucre. La thébaïne est un matériau de départ pour de nombreux médicaments opioïdes par des voies biosynthétiques et semi-synthétiques. Les flèches pleines indiquent les étapes catalysées par des enzymes. Flèches gris clair, enzymes de levure non modifiées flèches gris foncé, enzymes de levure surexprimées et modifiées flèches violettes, mammifère (Rattus norvegicus) enzymes flèches oranges, bactériennes (Pseudomonas putida) enzymes flèches vertes, plante (Papaver somniferum, P. bracteatum, Coptis japonica, Eschscholzia californica) enzymes. Le contour jaune met en évidence le contour rouge du DRS-DRR met en évidence le SalSyn conçu. E4P, érythrose 4-phosphate PEP, phosphoénolpyruvate DAHP, 3-désoxy- d -arabeAcide -2-heptulosonique 7-phosphate 4-HPP, 4-hydroxyphénylpyruvate 4-HPAA, 4-hydroxyphénylacétaldéhyde BH4, 5,6,7,8-tétrahydrobioptérine Tkl1p, transcétolase CPR, cytochrome P450 réductase Aro4p Q166K , DAHP synthase Aro1p, pentafonctionnelle arom enzyme Aro2p, chorismate synthase bifonctionnelle et flavine réductase Aro7p T226I , chorismate mutase Tyr1p, préphénate déshydrogénase Aro8p, aminotransférase aromatique I Aro9p, aminotransférase aromatique II Aro10p, phénylpyruvate décarboxylase TyrH WR37lasty inhibition de la rétroaction, R166E hydroxyline Y , l -DOPA décarboxylase NCS, (S)-norcoclaurine synthase 6OMT, norcoclaurine 6-O-méthyltransférase CNMT, coclaurine N-méthyltransférase NMCH, N-méthylcoclaurine hydroxylase 4′OMT, 3′-hydroxy-N-méthylcoclaurine 4′-O-méthyltransférase DRS-DRR, 1,2-déhydroréticuline synthase-1,2-déhydroréticuline réductase SalSyn, salutaridine synthase SalR, salutaridine réductase SalAT, salutaridinol 7-O-acétyltransférase T6ODM, thébaïne 6-O-déméthylase morB, morphinone réductase. Voir les fig. S1 et S2 pour les détails de la BH4 voie de biosynthèse, de recyclage et de récupération, conversion de (S)-norcoclarine à (S)-réticuline, et modules de voie génétique. (B) Optimisation de la souche plate-forme productrice de réticuline par voie et ingénierie des souches. La réticuline dans les milieux de croissance a été analysée par LC-MS/MS de surveillance des réactions multiples (MRM) et quantifiée avec une courbe standard externe. Les barres d'erreur représentent SD de trois répétitions biologiques. (C) Analyse chirale de la réticuline produite par la souche plate-forme. La réticuline a été isolée du milieu de croissance de la souche CSY1061 et séparée sur une colonne chirale. Ce chromatogramme est l'une des deux traces similaires de cultures de levures répliquées et a été lissé à l'aide d'une moyenne mobile de wagons couverts à 7 points.

Les modules BIA ont été intégrés dans une souche haploïde sauvage CEN.PK2. Nous avons dosé la production de réticuline en cultivant des souches de levure dans des milieux complets synthétiques minimaux supplémentés en acide ascorbique sans sulfate d'ammonium pendant 72 heures (fig. S3) et en analysant les milieux de croissance pour les molécules BIA par chromatographie liquide couplée à la spectrométrie de masse en tandem (LC-MS/MS ) (tableau S2). Une souche productrice de réticuline minimale (CSY1057 tableau S3), qui incorporait les modules II à IV, produisait de la réticuline avec un titre de 12,3 g/litre (Fig. 1B, fig. S4A et tableau S4). L'ajout du module I à la souche, augmentant l'apport de précurseurs BIA, a entraîné une amélioration d'un facteur 1,6 de l'accumulation de réticuline, avec ou sans Aro10p (CSY1059, 20,0 g/litre CSY1058, 20,7 g/litre). Nous avons observé une consommation quasi complète de l-DOPA (90 μg/litre fig. S4B et tableau S4), une accumulation substantielle de dopamine (10 mg/litre fig. S4C), et une accumulation de 3′-hydroxy-N-méthylcoclaurine (fig. S4, D et E) par LC-MS/MS pour la souche hébergeant les modules I à IV (CSY1059). Nous avons émis l'hypothèse que (i) une expression accrue de NCS augmenterait la conversion de la dopamine et du métabolite de levure natif 4-HPAA en norcoclaurine et produits en aval, (ii) une expression accrue de TyrH WR reconstituerait l'approvisionnement en dopamine, et (iii) une expression accrue de 4′OMT réduirait l'accumulation de 3′-hydroxy-N-méthylcoclaurine et augmenter le flux en réticuline. Ainsi, nous avons conçu un module de goulot d'étranglement (V), qui a codé la surexpression de trois protéines—TyrH WR , 4′OMT et NCS—par incorporation de copies de gènes supplémentaires. Le module a été intégré dans CSY1059 et conçu pour assommer le natif ZWF1 gène (zwf1Δ CSY1061) ou à intégrer dans un locus séparé (CSY1060). Une souche plate-forme de levure avec l'ajout du module V dans le zwf1 locus a entraîné une amélioration supplémentaire d'un facteur 4 de l'accumulation de réticuline (82 μg/litre Fig. 1B et tableau S4) et une diminution correspondante d'un facteur 2 de l'accumulation de 3′-hydroxy-N-méthylcoclaurine par rapport au CSY1059 (fig. S4D).

La réticuline produite par la souche de levure plate-forme CSY1061 a été isolée par chromatographie liquide à haute performance en phase inverse et analysée par LC-MS chirale. L'analyse chirale a indiqué que la majorité de la réticuline produite est le (S)-énantiomère (Fig. 1C), comme on s'y attendait en raison de la stéréospécificité de la condensation catalysée par NCS. La production principalement du (S)-énantiomère dans notre souche plate-forme corrobore des observations similaires d'autres bactéries et levures modifiées avec les trois enzymes méthyltransférase, même lorsqu'elles sont nourries avec des substrats racémiques (10, 1517). Le pavot à opium a la capacité unique de convertir (S)-réticuline à (R)-réticuline, dont dérivent les alcaloïdes morphiniques (26, 27). Bien que des études approfondies sur l'alimentation en isotopes et la biochimie aient indiqué que l'activité de l'épimérase passe par l'oxydation en un intermédiaire de base de Schiff et une réduction stéréospécifique (Fig. 2A), la 1,2-déhydroréticuline synthase (DRS) et la 1,2-déhydroréticuline réductase (DRR) enzyme(s) n'avaient pas été isolées et séquencées lorsque nous avons commencé notre étude (2729). Pendant que nous préparions ce manuscrit pour soumission, un groupe a signalé la découverte de cette enzyme dans P. somniferum en caractérisant les allèles mutants de plants de pavot à opium mutagénisés chimiquement (19). Alors que notre manuscrit était en cours d'examen, un autre groupe a signalé avoir utilisé des bases de données de transcriptomes végétaux pour identifier des candidats, puis a cloné le gène de P. somniferum ADNc (20). Notre approche a plutôt tiré parti des bases de données de transcriptomes végétaux, de la synthèse d'ADN et de l'ingénierie (S)-souches de levure productrices de réticuline, ne nécessitant donc pas l'accès à du matériel végétal physique.

(UNE) Schéma biosynthétique pour la réaction catalysée par DRS-DRR Me, méthyle. (B) Identification de DRS-DRR via une analyse bioinformatique de séquences de type COR. La requête bioinformatique était la séquence COR VIGS. Les séquences de sujets étaient les P. bracteatum Transcriptome PhytoMetaSyn P. bracteatum, P. setigerum, P. somniferum, et P. rhoeas transcriptomes du 1000 Plants Project et toutes les séquences déposées dans GenBank appartenant à Papavéracées. La barre d'échelle indique la quantité de changement génétique dans les substitutions d'acides aminés par site. Les branches surlignées en rouge indiquent des séquences contenant à la fois des domaines de type CYP et COR. L'arbre phylogénétique a été généré à l'aide de l'arbre de jointure de voisin bootstrap ClustalX avec 1000 essais. (C) Analyse chirale de la réticuline produite par des souches de levure exprimant et n'exprimant pas l'enzyme DRS-DRR. L'analyse chirale de la réticuline accumulée dans le milieu de croissance de la souche CSY1071 avec un vecteur vide ou DRS-DRR (pCS3301) a été réalisée comme décrit sur la figure 1C. Ce chromatogramme est l'une des deux traces similaires de cultures de levures répliquées et a été lissé à l'aide d'une moyenne mobile de wagons couverts à 7 points.

Plus précisément, nous avons noté que deux études indépendantes de silençage génétique des plantes ont révélé que le knockdown de la codéinone réductase (COR) entraîne une accumulation de réticuline, et dans un cas spécifiquement (S)-accumulation de réticuline (30, 31). Nous avons émis l'hypothèse qu'une enzyme de type COR pourrait catalyser la réduction stéréospécifique et avons utilisé la séquence publiée de silençage génique induit par le virus (VIGS) comme requête BLAST contre Papaver espèces dans le projet 1000 plantes (32) et PhytoMetaSyn (33, 34) bases de données de transcriptome. L'identité du hit a été déterminée par une recherche BLAST inversée contre des séquences déposées dans GenBank. Sur les 38 séquences de type COR identifiées qui mesuraient également plus de 300 nucléotides de long, quatre avaient un domaine de type cytochrome P450 oxydase (CYP) 82Y1 et un domaine de type COR dans un seul cadre de lecture ouvert (DRS-DRR Fig. 2B ). Nous avons considéré que cette protéine de fusion naturelle pouvait catalyser à la fois l'oxydation et la réduction nécessaires pour (S)-épimérisation réticuline. Nous proposons que l'oxydation en 1,2-déhydroréticuline puisse se produire via un intermédiaire carbinolamine ou énamine, et que la 1,2-déhydroréticuline est ensuite réduite stéréospécifiquement en (R)-réticuline par le domaine DRR de type COR (fig. S5).

Pour identifier d'autres variantes de cette séquence codante et déterminer à quel point elle est répandue dans la nature, nous avons utilisé la séquence d'acides aminés de P. bracteatum DRS-DRR (Pbr.89405) pour rechercher dans les deux bases de données par nucléotides BLAST traduits (tBLASTn). Une recherche de toutes les séquences dans la base de données PhytoMetaSyn (67 espèces végétales) et la base de données de transcriptome 1000 Plants Project (1328 assemblages dérivés de quelques centaines d'espèces végétales) a identifié un total de cinq séquences apparentes complètes et 10 séquences uniques partielles qui abritaient les deux domaines (fig. S6), originaire de P. somniferum (grain d'opium), P. setigerum (coquelicot de Troie), P. bracteatum (pavot d'Iran), ou Chelidonium majus (grande chélidoine). A partir de cette recherche secondaire (fig. S6), nous avons identifié un P. somniferum Séquence DRS-DRR d'intérêt, Pso.2062398, qui était une séquence complète qui avait un consensus avec plusieurs hits de transcriptome individuels.

Pour déterminer si l'enzyme DRS-DRR identifiée possède une activité épimérase, nous avons caractérisé l'enzyme DRS-DRR dans le contexte d'une souche de levure conçue pour produire (S)-réticuline de l'alimentation course-norlaudanoline (CSY1071 fig. S1C) (11). Dans des expériences préliminaires, nous avons criblé les trois variantes de P. bracteatum qui se sont regroupés dans la recherche initiale - Pbr.89405, Pbr.12180 et Pbr.4328 - dans la souche CSY1071 avec des plasmides à faible nombre de copies hébergeant des cassettes d'expression pour le DRS-DRR optimisé pour les codons de levure et les codons de levure optimisés P. somniferum salutaridine synthase (yPsSalSyn). L'optimisation des codons de tous les gènes synthétiques a été réalisée par Life Technologies (35). Lorsqu'elle a été alimentée avec 1 mM de norlaudanosoline, seule la souche codant pour le variant de DRS-DRR Pbr.89405 a produit une salutaridine substantielle. Nous avons cultivé la souche CSY1071 contenant le plasmide à faible nombre de copies hébergeant ce DRS-DRR (Pbr.89405, pCS3301) avec 1 mM course-norlaudanosoline pendant 72 heures, et réticuline isolée du milieu de croissance pour une analyse LC-MS chirale. Dans les souches exprimant le DRS-DRR, plus de la moitié de la réticuline produite était le (R)-énantiomère, alors qu'exclusivement (S)-réticuline a été détectée dans des souches dépourvues du gène DRS-DRR (Fig. 2C).

Nous avons ensuite examiné l'activité des variantes enzymatiques DRS-DRR dans le contexte des étapes de conversion en aval en thébaïne, le premier alcaloïde morphinane dans la biosynthèse des opiacés. Dans des expériences préliminaires, des variants de la salutaridine réductase (SalR) optimisés pour les codons de levure provenant de P. bracteatum et P. somniferum et les mutants dirigés qui ont été signalés pour réduire l'inhibition du substrat et augmenter la vitesse maximale de réaction Vmax (36, 37) ont été examinés pour leur capacité à catalyser la conversion de la salutaridine en thébaïne avec des variants de la salutaridinol acétyltransférase (SalAT) optimisés pour les codons de levure provenant de P. somniferum, P. bracteatum, et P. orientale. Les P. bracteatum SalR (PbSalR) et P. somniferum Les enzymes SalAT (PsSalAT) présentaient les activités les plus élevées chez la levure (fig. S7, A et B). Un chromosome artificiel de levure (YAC, pCS3308) codant pour des cassettes d'expression pour yPsSalSyn, PbSalR et PsSalAT a été assemblé dans la souche CSY1071, et les variants DRS-DRR ont été exprimés à partir de plasmides à faible nombre de copies (pCS3300-3305). Les souches résultantes ont été dosées en alimentant 1 mM rac-norlaudanosoline pendant 72 heures, et le milieu de croissance a été analysé pour la production de thébaïne. P. bracteatum et P. somniferum Les enzymes DRS-DRR (Pbr.89405, Pso.2062398) ont entraîné une production similaire de thébaïne (fig. S7C), et la P. bracteatum DRS-DRR (PbDRS-DRR) a été utilisé dans des expériences ultérieures. Des cassettes d'expression pour les quatre gènes ont été assemblées dans un YAC (pCS3309) dans la souche CSY1071, et la souche résultante a été testée pour la production de thébaïne à partir d'aliments course-norlaudanosoline. Cette souche a produit de la thébaïne à une concentration de 17 g/litre lorsqu'elle a été cultivée avec 1 mM course-norlaudanosoline pendant 96 heures (Fig. 3C et tableau S5). Cependant, une accumulation substantielle de la réticuline intermédiaire (

(UNE) Schéma de la stratégie d'ingénierie chimérique SalSyn pour résoudre le traitement incorrect et la glycosylation du SalSyn de type sauvage dans la levure. Les losanges oranges représentent la glycosylation. (B) Comparaison de la salutaridine produite à partir de variants SalSyn, de mutants de glycosylation dirigée et de fusions modifiées dans la levure. Les souches de levure exprimant le variant SalSyn indiqué ont été nourries à 10 M (R)-réticuline, et le milieu de croissance a été analysé par LC-MS/MS MRM. Les zones de pic ont été normalisées à SalSyn de type sauvage (noir). (C) Comparaison de la thébaïne produite à partir de variants SalSyn dans la levure. Les souches de levure ont été nourries à 1 mM course-norlaudanosoline, et la thébaïne dans le milieu de croissance a été quantifiée par LC-MS/MS MRM avec une courbe standard externe. Les barres entourées de noir indiquent le type sauvage et la variante la mieux conçue. Les barres d'erreur sont des SD d'au moins trois réplicats biologiques.

Parce que DRS-DRR est assez efficace dans la conversion de (S)- à (R)-réticuline (Fig. 2C), l'accumulation de réticuline a indiqué que la conversion de (R)-réticuline en salutaridine, catalysée par SalSyn, a justifié une optimisation supplémentaire. L'analyse par transfert Western a indiqué que la protéine SalSyn exprimée par la levure était présente sous trois formes qui pouvaient être distinguées par le poids moléculaire apparent, tandis que SalSyn était exprimée de manière transitoire dans Nicotiana benthamiana (tabac) était présent principalement au plus bas de ces trois poids moléculaires apparents (fig. S8A). La mutagenèse dirigée de trois sites potentiels de glycosylation liée à N [Asn-X-Thr/Ser (N-X-T/S)] a indiqué que les trois bandes provenaient de la glycosylation de la protéine sur deux sites, Asn 105 et Asn 331. La glycosylation N-liée dans la levure indique un tri N-terminal incorrect du polypeptide SalSyn naissant vers la lumière du réticulum endoplasmique (RE), où il est N-glycosylé plutôt que d'ancrer l'extrémité N dans la membrane externe du RE et de maintenir la domaine catalytique dans le cytosol, comme c'est typique des CYP microsomiques (Fig. 3A et Fig. S8B) (38, 39). Nous avons émis l'hypothèse que ce mauvais traitement réduisait l'activité de SalSyn dans la levure. Cependant, la modification du schéma de glycosylation de SalSyn en mutant les sites de glycosylation a réduit la conversion de (R)-réticuline en salutaridine par rapport à l'enzyme de type sauvage optimisée pour les codons de levure (Fig. 3B).

Nous avons effectué une ingénierie des protéines pour corriger le tri N-terminal du polypeptide SalSyn naissant, empêcher la glycosylation liée à N et améliorer l'activité de l'enzyme dans la levure. La cheilanthifoline synthase (CFS) est un cytochrome P450 végétal identique à 61 à 68 % à SalSyn, présente une activité élevée lorsqu'elle est exprimée dans la levure (14), et n'est pas glycosylée dans la levure malgré un site N-X-T/S identique à la séquence SalSyn (fig. S8C). Nous avons conçu des séquences codantes optimisées pour les codons de levure pour les protéines chimériques avec une ou plusieurs hélices N-terminales de CFS remplaçant celles des variants SalSyn de P. somniferum et P. bracteatum, avec des points de jonction pour les fusions sélectionnés sur la base d'alignements d'acides aminés et/ou de motifs de structure secondaire de protéines. L'analyse par transfert Western des protéines chimériques a indiqué que plusieurs des enzymes SalSyn modifiées étaient présentes sous forme d'une seule bande dans la levure, similaire au modèle d'expression observé pour l'enzyme parent exprimée par la plante (fig. S8D). Les données ont indiqué que le mauvais traitement de la protéine naissante dans la levure qui a entraîné une glycosylation liée à N a été réparé par les fusions modifiées. Comme stratégie alternative, la séquence codante pour le domaine SalSyn CYP a été clonée à la place du domaine CYP dans le cytosol Bacillus mégaterium P450 monooxygénase CYP102A1 (BM3), résultant en une protéine chimérique avec des domaines fusionnés CYP et cytochrome P450 réductase. Les protéines chimériques SalSyn ont été exprimées à partir d'un plasmide à faible nombre de copies dans CSY1071 et testées pour la production de salutaridine à partir d'aliments (R)-réticuline. Plusieurs des variantes modifiées de SalSyn ont présenté une activité améliorée par rapport aux enzymes de type sauvage et optimisées pour les codons, avec la P. bracteatum variant yEcCFS 1-83 -yPbSalSyn 92-504 présentant une plus grande conversion de (R)-réticuline en salutaridine par un facteur de

6 (Fig. 3B) et une plus grande conversion de course-norlaudanosoline à la thébaïne par un facteur de >3 (55 g/litre Fig. 3C et tableau S5) par rapport à PsSalSyn de type sauvage.

Pour concevoir une souche de levure qui produit de la thébaïne à partir de sources simples de carbone et d'azote, nous avons conçu un module de thébaïne (VI) qui code l'expression des meilleurs variants enzymatiques identifiés dans notre travail : PbDRS-DRR, yEcCFS 1-83 -yPbSalSyn 92-504 , PbSalR et PsSalAT—pour convertir (S)-réticuline à l'alcaloïde morphinane thébaïne. La thébaïne est extraite du pavot à opium pour être utilisée dans la semisynthèse d'un certain nombre d'opioïdes. Ce module a été ajouté à la souche plate-forme productrice de réticuline (CSY1060) en tant qu'intégration chromosomique (CSY1064). Les souches résultantes ont été cultivées dans des milieux minimaux pendant 120 heures et les milieux de croissance dosés pour la thébaïne (Fig. 4, A et B). Ces souches contenant 24 cassettes d'expression hétérologues, 21 nouvelles activités enzymatiques, la surexpression de deux enzymes natives et l'inactivation d'une enzyme native ont produit de la thébaïne à des concentrations de 6,4 ± 0,3 µg/litre (tableau S6). Nous avons ensuite étendu la voie biosynthétique reconstruite à un médicament opioïde en aval, l'hydrocodone (Fig. 1A), qui est un composant principal du deuxième médicament sur ordonnance le plus délivré aux États-Unis (40). Un module hydrocodone (VII), qui code l'expression de la thébaïne 6-O-déméthylase (T6ODM) de P. somniferum et la morphine réductase (morB) de P. putida M10 (13), a été introduit sous forme de YAC (pCS2765) dans la souche productrice de thébaïne CSY1064. La souche résultante a été cultivée dans un milieu minimal avec 50 mM de 2-oxoglutarate pour soutenir l'activité T6ODM pendant 120 heures et le milieu de croissance a été testé pour les composés opioïdes (Fig. 4, C et D, et tableau S6). La levure modifiée était capable de produire de faibles niveaux d'hydrocodone,

0,3 µg/litre. Ainsi, nous avons démontré la faisabilité d'étendre la voie aux composés d'intérêt par une voie biosynthétique qui n'est pas présente dans le pavot à opium natif sans avoir à incorporer la synthèse chimique en aval.

(UNE) Chromatogrammes de thébaïne détectés dans les milieux CSY1064 et dans un standard de thébaïne (7,8 µg/litre, 25 nM). (B) Spectres de huit transitions MRM de la thébaïne produites par la levure modifiée et le standard de thébaïne. (C) Chromatogrammes d'hydrocodone détectés dans les milieux CSY1064+pCS2765 et dans un standard d'hydrocodone (0,3 µg/litre, 1 nM). () Spectres de quatre transitions MRM d'hydrocodone produites par la levure modifiée et le standard d'hydrocodone. Le milieu de croissance a été analysé pour les opioïdes par LC-MS/MS MRM. Les traces sont représentatives de quatre réplicats biologiques.

Ce travail représente la biosynthèse complète des opiacés chez un hôte hétérologue à partir du métabolisme central. Grâce à notre approche synthétique, nous avons validé la capacité des variants DRS-DDR de différentes plantes à catalyser le (S)- à (R)-épimérisation de la réticuline dans le cadre de la voie de biosynthèse hétérologue des opiacés. L'ingénierie de la levure capable de convertir les métabolites centraux en l'échafaudage complexe du morphinane pentacyclique a nécessité une ingénierie enzymatique pour corriger le traitement et augmenter l'activité de la voie clé du cytochrome P450 menant à l'échafaudage du promorphinane (SalSyn), ainsi que l'optimisation de la voie et de la souche, y compris l'expression de 21 enzymes hétérologues provenant de plantes, de mammifères, de bactéries et de levures, la surexpression de deux enzymes de levure natives et la délétion d'un gène de levure native. Le rapport actuel représente une preuve de principe pour générer des échafaudages de morphinane de novo dans la levure, et ouvre la possibilité de dériver ces molécules et d'autres par de nouvelles voies biosynthétiques ou semi-synthétiques pour améliorer leurs propriétés thérapeutiques.

5 g/litre seraient nécessaires pour que la production d'opioïdes à base de levure soit une alternative faisable à la culture du pavot pour la production commerciale. Comme cela représente une augmentation de rendement de plus de cinq ordres de grandeur, les souches rapportées ici ne conviendraient pas à une mise à l'échelle commerciale. Les futurs efforts d'ingénierie pourraient tirer parti du rôle de la voie en tant que puits d'électrons pour la production fermentative pour diriger un plus grand flux d'électrons et de carbone vers les opiacés plutôt que vers l'éthanol ou d'autres produits de fermentation. Aux productivités commerciales,

5 ml de levure cultivée sur plusieurs jours fourniraient une dose d'analgésique, qui provient actuellement de 0,2 m 2 de champ de pavot au cours d'une année. requis pour la production par un facteur de >500.

Certains craignent que la biosynthèse des opioïdes dans la levure ne conduise bientôt à des opiacés « maison » (41). Les niveaux de production atteints ici dans des conditions de fermentation contrôlées ne permettent pas de brasser maison de ces médicaments et ne sont pas non plus économiquement compétitifs avec la culture du pavot pour l'approvisionnement des marchés licites ou illicites. Plus précisément, aux titres rapportés ici (<1 μg/litre), une dose unique d'hydrocodone, telle qu'utilisée dans Vicodin (5 mg), nécessiterait des milliers de litres de bouillon de fermentation, qu'aucun brasseur amateur ne poursuivrait raisonnablement. De telles améliorations ne sont pas simplement une question de mise à l'échelle de la fermentation et nécessiteraient des recherches supplémentaires pour obtenir les améliorations nécessaires des souches et des voies. Ainsi, les travaux rapportés ici ne fournissent pas de « recette » pour fabriquer des médicaments opioïdes d'une manière qui porte directement atteinte à la santé ou à la sécurité publiques. Néanmoins, pour garantir la santé publique future, nos souches de levure ne produisent que des opioïdes (par exemple, l'hydrocodone, la thébaïne) avec un potentiel réduit de détournement vers les marchés illicites en raison des étapes supplémentaires et du coût de la conversion chimique de ces composés spécifiques en héroïne. Bien que de telles souches puissent potentiellement être modifiées pour produire directement de la morphine, des travaux antérieurs pour convertir la thébaïne en morphine n'ont réalisé qu'un rendement de 1,5% (13). Ainsi, à titre d'estimation approximative, une souche qui convertit le sucre en morphine nécessiterait une amélioration du rendement global d'un facteur de

7 × 10 6 par rapport au travail rapporté ici.

Malgré cette précaution, une amélioration substantielle de la production d'opioïdes via la levure devrait être attendue dans les prochaines années. Plus largement, nos travaux mettent en évidence le potentiel de la levure en tant que châssis pour la production biosourcée de nombreux produits chimiques et matériaux complexes. La biologie synthétique est sur le point de remplacer ou de compléter de nombreuses chaînes d'approvisionnement par une fabrication biosourcée avancée. Une capacité considérablement élargie à construire avec la biologie contribuera à des changements dans l'utilisation des terres et des ressources naturelles, l'emploi et la politique. Des stratégies pratiques qui répondent aux préoccupations tout en permettant l'innovation et la réalisation d'avantages doivent être développées dès maintenant afin de sécuriser notre future bioéconomie. Compte tenu de la complexité et de la diversité à la fois des préoccupations potentielles et des avantages possibles, nous appuierons fortement un processus délibératif ouvert qui développe des options pour la gouvernance (42) de la biosynthèse de composés médicinaux avant que des processus économiquement compétitifs soient réalisés.


Caroténoïdes dans la nature

Ce livre complet et édité explore les caroténoïdes et leurs rôles fonctionnels importants dans la levure, les bactéries et les plantes et une exposition approfondie sur les structures des molécules de caroténoïdes, en se concentrant dans la première des trois parties sur la biosynthèse des caroténoïdes. La régulation de la biosynthèse des caroténoïdes dans la photosynthèse ainsi que dans les plantes, les fruits, les racines de stockage et les algues est au cœur de la deuxième partie, et les découvertes sur la fonction des caroténoïdes dans la santé humaine figurent dans la troisième et dernière partie. De nombreuses illustrations, explications, aperçus et exemples utiles aident à informer les lecteurs sur des thèmes pertinents, notamment les gènes caroténogènes, les caroténoïdes dans les fruits et l'ingénierie métabolique.

Le livre explore où les caroténoïdes sont synthétisés dans la nature, y compris dans les carottes et les algues. Les auteurs experts contributeurs examinent les fonctions enzymatiques et les modèles végétaux, et analysent la structure des molécules de caroténoïdes. La fonction des caroténoïdes dans la photosynthèse et dans les organes photosynthétiques ainsi que lors de la maturation des fruits est ensuite explorée. Un chapitre entier est consacré aux dernières recherches sur les apocaroténoïdes et d'autres chapitres couvrent des thèmes intéressants et nouveaux sur le développement des plastes et la régulation épigénétique qui affecte la synthèse des caroténoïdes chez les plantes. L'ingénierie métabolique des caroténoïdes qui a été réalisée dans les fruits, les plantes et les graines est un autre domaine que les lecteurs peuvent explorer, ainsi que des preuves sur la fonction des caroténoïdes dans la nutrition humaine, en tant qu'antioxydants, comme dans le contrôle du métabolisme des lipides et dans l'absorption de caroténoïdes.

Il s'agit d'un travail très instructif et de grande envergure qui mettra à jour les chercheurs dans le domaine, ainsi que le soutien aux étudiants en physiologie et biotechnologie végétales, en tant que lecture supplémentaire.


Akhter, S., Aziz, R. K. et Edwards, R. A., 2012. Phispy : Un nouvel algorithme pour trouver des prophages dans les génomes bactériens qui combine des stratégies basées sur la similarité et la composition. Recherche sur les acides nucléiques, 40. (16): 329–334.

Arrach, N., Fernandez-Martin, R., Cerda-Olmedo, E. et Ava-los, J., 2001. Un gène unique pour la lycopène cyclase, la phytoène synthase et la régulation de la biosynthèse du carotène chez Phyco-myces. Actes de l'Académie nationale des sciences des États-Unis d'Amérique, 98. (4): 1687–1692.

Buzzini, P., Innocenti, M., Turchetti, B., Libkind, D., van Broock, M. et Mulinacci, N., 2007. Profils caroténoïdes de levures appartenant aux genres Rhodotorula, Rhodosporidium, Sporobolomyces, et Sporidiobole. Journal canadien de microbiologie, 53. (8): 1024–1031.

Chin, CS, Peluso, P., Sedlazeck, FJ, Nattestad, M., Conception, GT, Clum, A., Dunn, C, O'Malley, R., Figueroa-Balderas, R. et Morales-Cruz, A., 2016.Assemblage du génome diploïde par phases avec séquençage en temps réel d'une seule molécule. Méthodes naturelles, 13. (12): 1050–1054.

Dasgupta, D., Sharma, T., Bhatt, A., Bandhu, S. et Ghosh, D., 2017. Culture de levure oléagineuse Rhodotorula mucilaginos. IIPL32 dans un réacteur airlift à colonnes divisées et son influence sur les propriétés du combustible. Biocatalyse et biotechnologie agricole, 10: 308–316.

Deligios, M., Fraumene, C., Abbondio, M., Mannazzu, I., Tanca, A., Addis, M. F. et Uzzau, S., 2015. Projet de séquence du génome de Rhodotorula mucilaginosa, un pathogène opportuniste émergent. Annonces du génome, 3 (2): 1–2.

Frengova, G. I. et Beshkova, D. M., 2009. Caroténoïdes de Rhodotorul. et Phaffia. Levures d'importance biotechnologique. Journal of Industrial Microbiology & Biotechnology, 36 (2): 163–180.

Gan, H. M., Thomas, B. N., Cavanaugh, N. T., Morales, G. H., Mayers, A. N., Savka, M. A. et Hudson, A. O., 2017. Séquençage du génome entier de Rhodotorula mucilaginos. isolé du bâton à mâcher (Distemonanthus bentha-mianus) : Regards sur La phylogénie des Rhodotorula, la dynamique du mitogénome et la biosynthèse des caroténoïdes. PairJ, 5 (1) : e4030.

Hawksworth, D.L., Kirk, P.M., Sutton, B.C. et Pegler, D.N., 1996. Ainsworth & Bisby's Dictionary of the Fungi. Revista do Instituto de Medicina Tropical de Sao Paulo, 38. (4): 17–19.

Hernandez-Almanza, A., Montanez, J. C., Aguilar-Gonzalez, M. A., Martinez-Avila, C, Rodriguez-Herrera, R. et Aguilar, C. N., 2014. Rhodotorula glutini. comme source de pigments et de métabolites pour l'industrie alimentaire. Biosciences alimentaires, 5. (Complet) : 64-72.

Huerta-Cepas, J., Szkrarczyk, D., Forslund, K., Cook, H., Heller, D., Walter, MC, Rattei, T., Mende, DR, Sunagawa, S. et Kuhn, M. , 2016. eggNOG 4.5 : Un cadre d'orthologie hiérarchique avec des annotations fonctionnelles améliorées pour les séquences eucaryotes, procaryotes et virales. Recherche sur les acides nucléiques, 44: D286-D293.

Ignatova, L. V., Brazhnikova, Y. V., Berzhanova, R. Z. et Mukasheva, T. D., 2015. Stimulation de la croissance des plantes et activité antifongique des levures du sol de châtaignier foncé. Recherche microbiologique, 175: 78–83.

Koonin, EV, Fedorova, ND, Jackson, JD, Jacobs, AR, Krylov, DM, Makarova, KS, Mazumder, R., Mekhe-dov, SL, Nikolskaya, AN et Rao, BS, 2004. Une classification évolutive complète de protéines codées dans des génomes eucaryotes complets. Biologie du génome, 5 (2) : R7-R7.

Kot, A. M., Blazejak, S., Gientka, I., Kieliszek, M. et Brys, J., 2018. Torulene et torularhodin : de « nouveaux » caroténoïdes fongiques pour l'industrie ? Usines de cellules microbiennes, 17. (1): 49.

Landolfo, S., Ianiri, G., Camiolo, S., Porceddu, A., Mulas, G., Chessa, R., Zara, G. et Mannazzu, I., 2018. gènes caroténogènes dans Rhodotorula mucilaginosa. Microbiologie, 164. (1): 78–87.

Li, C., Zhang, N., Li, B., Xu, Q., Song, J., Wei, N., Wang, W. et Zou, H., 2017. Augmentation de l'accumulation de torulene dans la levure rouge Sporidiobolus pararoseu. NGR comme réponse au stress à des conditions salines élevées. chimie alimentaire, 237: 1041–1047.

Lomsadze, A., Terhovhannisyan, V., Chernoff, Y. O. et Bo-rodovsky, M., 2005. Identification des gènes dans les nouveaux génomes eucaryotes par algorithme d'auto-apprentissage. Recherche sur les acides nucléiques, 30. (20): 6494–6506.

Ma, W., Chen, X., Wang, B., Lou, W., Chen, X., Hua, J., Sun, YJ, Zhao, Y. et Peng, T., 2017. Caractérisation, antioxydant -activité et activité anti-carcinome de l'extrait d'exopolysaccharide de Rhodotorula mucilaginos. CICC 33014. Polymères d'hydrates de carbone, 181: 768.

Mata-Gomez, L. C., Montanez, J. C., Mendez-Zavala, A. et Aguilar, C. N., 2014. Production biotechnologique de caroténoïdes par les levures : un aperçu. Usines de cellules microbiennes, 13. (1) : 12.p.

Medema, MH, Blin, K., Cimermancic, P., De Jager, V., Zakrzewski, P., Fischbach, MA, Weber, T., Takano, E., Breitling, R., 2011. AntiSMASH : Identification rapide , annotation et analyse de clusters de gènes de biosynthèse de métabolites secondaires dans des séquences de génomes bactériens et fongiques. Recherche sur les acides nucléiques, 39. (problème de serveur Web) : W339.

Minora, K., Goto, S., Kawashima, S., Okuno, Y. et Hattori, M., 2004. La ressource KEGG pour déchiffrer le génome. Recherche sur les acides nucléiques, 32: 277–280.

Akhtyamova, N. et Sattarova, R. K., 2013. Levure endophyte Rhodotorula rubr. souche TG-1 : Activités antagonistes et phytosanitaires. Biochimie et Rhysiologie, 2. (1) : 1000104. DOI : 10.4172/2168-9652.1000104.

Prado-Cabrero, A., Scherzinger, D., Avalos, J. et Al-Babili, S., 2007. Biosynthèse rétinienne chez les champignons : Caractérisation de la caroténoïde oxygénase CarX de Fusarium fujikuroi. Cellule eukaryotique, 6 (4): 650–657.

Rodriguez-Saiz, M., de la Fuente, J. L. et Barredo, J. L., 2010. Xanthophyllomyces dendrorhou. pour la production industrielle d'astaxanthine. Microbiologie appliquée et biotechnologie, 88: 645–658.

Saha, C., et Seal, A., 2015. Les premiers changements dans la transcription des pousses du riz en réponse à Rhodotorula mucilaginos. JGTA-S1. Données génomiques, 6: 237–240.

Salvadori, M. R., Ando, ​​R. A., Oiler do Nascimento, C. A. et Correa, B., 2014. Biosynthèse intracellulaire et élimination des nanoparticules de cuivre par la biomasse morte de levure isolée des eaux usées d'une mine en Amazonie brésilienne. Plos Un, 9(1) :e87968.

Sanz, C., Velayos, A., Alvarez, M. I., Benito, E. R. et Eslava, A. P., 2011. Analyse fonctionnelle du Voiture Phycomyces. gène codant pour les enzymes phytoène synthase et lycopène cyclase. PloS Un, 6. (8) : e23102.

Singh, P., Tsuji, M., Singh, S. M., Roy, U. et Hoshino, T., 2013. Caractérisation taxonomique, stratégies d'adaptation et potentiel biotechnologique des levures cryophiles des carottes de glace du glacier Midre Lovenbreen, Svalbard, Arctique. Cryobiologie, 66. (2): 167–175.

Tamura, K., Nei, M. et Kumar, S., 2004. Perspectives pour déduire de très grandes phylogénies en utilisant la méthode de jointure par voisins. Actes de l'Académie nationale des sciences des États-Unis d'Amérique, 101. (30): 11030–11035.

Wirth, F. et Goldani, L.Z., 2012. Épidémiologie de Rhodotorula. Un pathogène émergent. Perspectives interdisciplinaires sur les maladies infectieuses, 7.p, DOI : 10.1155/2012/465717.

Wozniak, A., Lozano, C., Barahona, S., Niklitschek, M., Marcoleta, A., Alcaino, J., Sepulveda, D., Baeza, M. et Cifuentes, V, 2011. Production différentielle de caroténoïdes et l'expression des gènes dans Xanthophyllomyces dendrorhou. cultivées dans une source de carbone non fermentescible. Recherche sur la levure de fougère, 11. (3): 252–262.

Zhang, H., Ge, L., Chen, K., Zhao, L. N. et Zhang, X. Y., 2014. Amélioration de l'activité de biocontrôle de Rhodotorula mucilaginosa, cultivées dans des milieux contenant du chitosane contre les maladies post-récolte des fraises : mécanismes possibles sous-jacents à l'effet. Journal de chimie agricole et alimentaire, 62. (18): 4214–4224.


Matériaux et méthodes

Clonage et mutagenèse dirigée de crtI et crtYB

Les ADNc correspondant à crtI (numéro d'accession GenBank AY177424.1) et crtYB (GenBank numéro d'accession AY177204.1) ont été isolés de X. dendrorhous par RT-PCR, et cloné dans le vecteur pMD18-T pour obtenir les constructions pMD18-T-crtI et pMD18-T-crtYB, respectivement, pour le séquençage de l'ADN. Pour déterminer les sites nucléotidiques dont la fréquence d'utilisation est < 15% dans S. cerevisiae, les séquences d'ADNc complètes de crtI et crtYB ont été analysés à l'aide d'un analyseur graphique d'utilisation des codons (GCUA Fuhrmann et al., 2004) avec la table d'utilisation des codons de S. cerevisiae. Par la suite, cinq nucléotides de crtI et huit nucléotides de crtYB ont été identifiés comme des sites médiocres (fréquence d'utilisation de < 15%) en ce qui concerne l'efficacité de la traduction dans S. cerevisiae. Sur la base de ces résultats, les sites de codons pauvres de crtI et crtYB ont été soumis à une mutation pour améliorer leur fréquence d'utilisation des codons. Tous les processus de mutagenèse dirigée ont été accomplis en chevauchant la PCR d'extension avec les amorces 5-30, en utilisant le plasmide pMD18-T-crtI ou pMD18-T-crtYB comme modèle ( Kanoksilapatham et al., 2007). Le muté crtI et crtYB ont été désignés comme McrtI et McrtYB, respectivement. Toutes les amorces utilisées pour la PCR dans cette étude sont répertoriées dans le tableau 1.

Amorces utilisées dans cette étude

Amorce no. La description Séquence (5′ à 3′)
1 crtI-F GGCGGATCCATGGGAAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GACATTCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTGCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTGCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Amorce no. La description Séquence (5′ à 3′)
1 crtI-F GGCGGATCCATGGGAAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GACATTCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTGCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTGCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Amorces utilisées dans cette étude

Amorce no. La description Séquence (5′ à 3′)
1 crtI-F GGCGGATCCATGGGAAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GACATTCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTGCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTGCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Amorce no. La description Séquence (5′ à 3′)
1 crtI-F GGCGGATCCATGGGAAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GACATTCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTGCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTGCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Constructions plasmidiques

Une cassette d'ADN pour l'expression de levure a été préparée dans le vecteur PUC19 pour obtenir la construction pLQ01 (Fig. 1). Le plasmide pLQ01 comprenait 680 pb TDH3 promoteur de gène et 250 pb CYC1 séquences de terminateur de gène, qui ont été amplifiées à partir de l'ADN génomique de S. cerevisiae en utilisant les amorces 31-34. Les cadres de lecture ouverts (ORF) de crtI, crtYB, McrtI et McrtYB étaient liés à la TDH3 promoteur et CYC1 terminateur en insérant les ORF dans le plasmide pLQ01 au site BamHI/NotI. La cassette d'expression'TDH3 promoteur-gène-CYC1 terminator' a ensuite été amplifié à l'aide des amorces 35-38. Les cassettes d'ADN'TDH3 promoteur-crtI-CYC1 terminateur' et 'TDH3 promoteur-McrtI-CYC1 terminator' ont été digérés avec les enzymes de restriction SpeI et SalI et introduits dans un vecteur d'expression de levure intégratif pRS406 aux sites SpeI/SalI, ce qui a donné les constructions pRS406-crtI et pRS406-McrtI, respectivement. Le fragment SalI/XhoI de ‘TDH3 promoteur-crtYB-CYC1 terminateur' a ensuite été ligaturé dans pRS406-crtI au site SalI/Xhol pour obtenir la construction pRS406W (Fig. 1). La même approche a été appliquée pour construire pRS406M en excisant le fragment SalI/XhoI de ‘TDH3 promoteur-McrtYB-CYC1 terminateur' et introduction dans pRS406-McrtI.

Structure des vecteurs. (a) pLQ01 contenant un TDH3 promoteur et un CYC1 terminateur. (b) pRS406. (c) pRS406W portant les gènes de type sauvage responsables de l'expression des caroténoïdes. (d) pRS406M portant les gènes d'expression optimisés des caroténoïdes. (e) pESC-TDH3-tHMG1 détient le domaine catalytique de tHMG1 gène dans Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 tenant le mva gène dérivé de Staphylococcus aureus.

Structure des vecteurs. (a) pLQ01 contenant un TDH3 promoteur et un CYC1 terminateur. (b) pRS406. (c) pRS406W portant les gènes de type sauvage responsables de l'expression des caroténoïdes. (d) pRS406M portant les gènes d'expression optimisés des caroténoïdes. (e) pESC-TDH3-tHMG1 détient le domaine catalytique de tHMG1 gène dans Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 tenant le mva gène dérivé de Staphylococcus aureus.

L'ORF de tHMG1 L'ADNc (séquence de référence NCBI NM_001182434.1) a été isolé par RT-PCR avec les amorces 39-40 de S. cerevisiae souche WAT11, et l'ADNc correspondant à mva (NCBI Reference Sequence NC_017342.1) a été amplifié en utilisant les amorces 41-42 de l'ADN génomique de S. aureus (ATCC25923). Les S. aureus souche a été aimablement fournie par le Dr Qiang Gao (Contrôle biologique des vecteurs Arborvirus, Institut de virologie de Wuhan, Académie chinoise des sciences). Grâce à la PCR d'extension chevauchante avec les amorces 43-44, l'ORF de tHMG1 était lié à la TDH3 promoteur pour obtenir le fragment ‘TDH3-tHMG1'. Le fragment d'ADN 'TDH3-tHMG1’ a ensuite été digéré et ligaturé dans un vecteur d'expression de levure pESC-HIS (Stratagene) au site SpeI/BamHI pour obtenir la construction pESC-HIS-TDH3-tHMG1. De même, l'ORF de mva a été cloné au TDH3 promoteur par PCR chevauchant en utilisant les amorces 45-46, puis ligaturé dans pESC-HIS au site EcoRI/BamHI pour obtenir le pESC-HIS-TDH3-mva vecteur. Dans les constructions pESC-HIS-TDH3-tHMG1 et pESC-HIS-TDH3-mva, les promoteurs endogènes inducteurs du galactose (Gal1 et Gal10) dans pESC-HIS ont été retirés (Fig. 1).

Construction et culture de souches de levure

Les vecteurs d'intégration pRS406, pRS406W et pRS406M ont été linéarisés avec StuI et intégrés dans le ura3-52 lieu de S. cerevisiae WAT11 pour créer les souches de levure WAT11/pRS406, WAT11/pRS406W et WAT11/pRS406M, en utilisant la méthode PEG/LiAc ( Gietz & Woods, 2002). Le vecteur épisomique pESC-HIS-TDH3-tHMG1 a été transformée dans la souche de levure WAT11/pRS406M pour obtenir WAT11/pRS406M-tHMG1. De même, la souche WAT11/pRS406M-mva a été préparé en transformant la construction pESC-HIS-TDH3-mva dans la souche de levure WAT11/pRS406M. En tant que témoin, le vecteur vide pESC-HIS a été transféré dans la souche de levure WAT11/pRS406M pour construire WAT11/pRS406M-HIS. Des informations détaillées concernant les souches de levure construites sont présentées dans le tableau 2.

Souches et plasmides utilisés dans cette étude

Souche ou plasmide Fonctionnalités pertinentes
Souches de levure WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformants vecteurs intégratifs
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Transformants vecteurs épisomiques
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmides
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
PESC-TDH3-tHMG1 PESC-TDH3-tHMG1-CYC1
PESC-TDH3-mva PESC-TDH3-mva-CYC1
Souche ou plasmide Fonctionnalités pertinentes
Souches de levure WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformants vecteurs intégratifs
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Transformants vecteurs épisomiques
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmides
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
PESC-TDH3-tHMG1 PESC-TDH3-tHMG1-CYC1
PESC-TDH3-mva PESC-TDH3-mva-CYC1

Souches et plasmides utilisés dans cette étude

Souche ou plasmide Fonctionnalités pertinentes
Souches de levure WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformants vecteurs intégratifs
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Transformants vecteurs épisomiques
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmides
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
PESC-TDH3-tHMG1 PESC-TDH3-tHMG1-CYC1
PESC-TDH3-mva PESC-TDH3-mva-CYC1
Souche ou plasmide Fonctionnalités pertinentes
Souches de levure WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformants vecteurs intégratifs
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Transformants vecteurs épisomiques
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmides
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
PESC-TDH3-tHMG1 PESC-TDH3-tHMG1-CYC1
PESC-TDH3-mva PESC-TDH3-mva-CYC1

Les souches de levure ont été cultivées à 250 tr/min et 30 °C dans un milieu liquide de levure approprié. Les souches WAT11/pRS406, WAT11/pRS406W et WAT11/pRS406M ont été cultivées dans du milieu SD-URA (milieu d'abandon des acides aminés), et les souches WAT11/pRS406M-tHMG1, WAT11/pRS406M-mva, et WAT11/pRS406M-HIS ont été cultivés dans du milieu SD-HIS-URA (milieu d'élimination des acides aminés). Pour surveiller la croissance de la levure, un seul clone de chacune des souches de levure a été initialement cultivé dans 5 ml de milieu de levure à 30 ° C sous agitation constante à une densité optique (mesurée à 600 nm OD600) de 0,6. Les cultures de levure ont ensuite été ensemencées dans du milieu SD frais dans un rapport de 1 : 40. Par la suite, 200 L des échantillons ont été prélevés à 0, 6, 12, 24, 30, 36, 48, 60, 72, 96 et 120. h pour mesurer la DO600.

Extraction et quantification du bêta-carotène

Les cellules de levure cultivées à 30 °C pendant 72 h dans 50 mL de milieu de levure ont été sédimentées par centrifugation à 3500 g pendant 5 min, lavé deux fois avec du NaCl à 0,9 % (p/v) et lyophilisé (Lange & Steinbuchel, 2011). Environ 100 mg de cellules lyophilisées ont été mis en suspension dans 2 ml d'acétone/0,2 % de pyrogallol dans du méthanol (p/v 80 : 20, v/v), et 1 g de billes de verre (diamètre, 425-600 m) a été ajoutée. Le mélange a été agité pendant 3 min dans un broyeur de tissus à haut débit, et la fraction acétone-méthanol a été recueillie par centrifugation à 6000 g pendant 5 minutes. L'extraction a été répétée quatre à cinq fois. Les extractions organiques ont été regroupées, évaporées à sec et redissoutes dans 1 ml d'acétone pour une analyse HPLC. Pour éviter la photo-oxydation, toutes les procédures d'extraction ont été réalisées à l'obscurité.

L'analyse HPLC a été réalisée sur un instrument LC-20AT équipé d'une pompe binaire, d'un échantillonneur automatique et d'un détecteur à matrice de photodiodes (Shimadzu, Kyoto, Japon). Une colonne Agilent HC-C18 (2) en phase inverse (4,6 × 250 mm, 5 µm) a été utilisée avec de l'acétonitrile/méthanol (50 : 50 v/v) comme phase mobile à un débit de 1 mL min -1 . La température de la colonne a été fixée à 25 °C et la longueur d'onde de détection était de 450 nm. Le bêta-carotène généré à partir des cultures de levure a été quantifié sur la base d'une courbe d'étalonnage standard réalisée avec du bêta-carotène authentique (Sigma Aldrich GmbH, Chine) de diverses concentrations.


Biosynthèse des caroténoïdes chez la levure - Biologie

Tous les articles publiés par MDPI sont rendus immédiatement disponibles dans le monde entier sous une licence en libre accès. Aucune autorisation particulière n'est requise pour réutiliser tout ou partie de l'article publié par MDPI, y compris les figures et les tableaux. Pour les articles publiés sous licence Creative Common CC BY en accès libre, toute partie de l'article peut être réutilisée sans autorisation à condition que l'article original soit clairement cité.

Les articles de fond représentent la recherche la plus avancée avec un potentiel important pour un impact élevé dans le domaine. Les articles de fond sont soumis sur invitation individuelle ou sur recommandation des éditeurs scientifiques et font l'objet d'un examen par les pairs avant leur publication.

L'article de fond peut être soit un article de recherche original, soit une nouvelle étude de recherche substantielle qui implique souvent plusieurs techniques ou approches, ou un article de synthèse complet avec des mises à jour concises et précises sur les derniers progrès dans le domaine qui passe systématiquement en revue les avancées les plus passionnantes dans le domaine scientifique. Littérature. Ce type d'article donne un aperçu des orientations futures de la recherche ou des applications possibles.

Les articles du Choix de l'éditeur sont basés sur les recommandations des éditeurs scientifiques des revues MDPI du monde entier. Les rédacteurs en chef sélectionnent un petit nombre d'articles récemment publiés dans la revue qui, selon eux, seront particulièrement intéressants pour les auteurs ou importants dans ce domaine. L'objectif est de fournir un aperçu de certains des travaux les plus passionnants publiés dans les différents domaines de recherche de la revue.


Article de recherche original

Jia Li 1 & 2020 , Jia Shen 1 & 2020 , Zhiqiang Soleil 1, Jing Li 1 , Changfu Li 1 , Xiaohua Li 1,2 et Yansheng Zhang 1*
  • 1 CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Chine
  • 2 Université de l'Académie chinoise des sciences, Pékin, Chine

β-Carotène est le précurseur de la vitamine A, et présente également de multiples fonctions pharmaceutiques par lui-même. Par rapport à la synthèse chimique, la production de β-carotène dans les microbes par stratégie d'ingénierie métabolique est relativement peu coûteuse. L'identification des gènes améliorant la production de β-carotène dans les microbes est importante pour concevoir une souche produisant des rendements plus élevés de β-carotène. La plupart des efforts antérieurs visant à identifier les gènes cibles se sont concentrés sur la voie des isoprénoïdes à laquelle appartient la biosynthèse du β-carotène. Cependant, en raison des interactions complexes entre les flux métaboliques, des gènes apparemment non pertinents qui se trouvent en dehors de la voie des isoprénoïdes pourraient également affecter la biosynthèse du β-carotène. À cette fin, nous avons fourni ici un exemple selon lequel plusieurs nouvelles cibles géniques, qui sont en dehors de la voie des isoprénoïdes, ont des effets améliorés sur la synthèse du β-carotène dans les cellules de levure, lorsqu'elles étaient surexprimées. Parmi ces cibles, la protéine de classe E de la voie de tri des protéines vacuolaires (Did2) a conduit à la plus forte amélioration des rendements en β-carotène, qui était 2,1 fois supérieure à celle du contrôle correspondant. Cette amélioration s'expliquait en outre par l'observation que la surexpression de la DID2 gène a généralement stimulé les transcriptions des gènes de la voie β-carotène. Le mécanisme par lequel les autres cibles améliorent la production de β-carotène est discuté.


Génétique et biologie moléculaire de la biosynthèse des pigments caroténoïdes

À qui la correspondance et les demandes de réimpression doivent être adressées, à: Institute for Plant Sciences, Plant Genetics, Swiss Federal Institute of Technology (ETH), CH-8092 Zürich, Switzerland.Rechercher d'autres articles de cet auteur

Département de chimie, Université de Californie, Division de biologie structurale, Laboratoire Lawrence Berkeley, Berkeley, Californie, 94720 États-Unis

Institut des sciences végétales, Génétique végétale, Institut fédéral suisse de technologie, CH-8092 Zurich, Suisse

À qui la correspondance et les demandes de réimpression doivent être adressées, à: Institute for Plant Sciences, Plant Genetics, Swiss Federal Institute of Technology (ETH), CH-8092 Zürich, Switzerland.Rechercher d'autres articles de cet auteur

Département de chimie, Université de Californie, Division de biologie structurale, Laboratoire Lawrence Berkeley, Berkeley, Californie, 94720 États-Unis

Résumé

Les rôles cruciaux des caroténoïdes et de leurs métabolites dans la protection photooxydante et la photosynthèse, sans parler de la nutrition, de la vision et de la différenciation cellulaire, en font une classe importante et complexe de pigments biologiques. Des progrès significatifs au cours des dernières années ont amélioré notre compréhension de la génétique et de la biologie moléculaire de la biosynthèse des caroténoïdes chez les bactéries, les champignons, les algues et les plantes. Tous les gènes impliqués dans la biosynthèse des caroténoïdes de Rhodobacter capsulatus, une bactérie photosynthétique anoxygénique, et de plusieurs espèces de Erwinia, bactéries non photosynthétiques, ont été caractérisées moléculairement. Des études récentes ont révélé que deux enzymes précoces de la biosynthèse des caroténoïdes, la géranylgéranyl pyrophosphate synthase et la phytoène synthase, sont structurellement et fonctionnellement apparentées dans tous les organismes caroténogènes. En revanche, la conversion ultérieure du phytoène, le premier C40 caroténoïde, au β-carotène nécessite deux désaturases et une cyclase dans les organismes photosynthétiques oxygénés (cyanobactéries, algues et plantes supérieures), mais une seule désaturase structurellement distincte et une cyclase structurellement distincte dans d'autres bactéries caroténogènes et dans les champignons. Les études sur les enzymes qui introduisent des groupes fonctionnels contenant de l'oxygène dans les carotènes pour produire des xanthophylles, la grande majorité de tous les caroténoïdes, en sont encore à leurs balbutiements. Cette revue résume les développements les plus récents de la biosynthèse des caroténoïdes d'un point de vue génétique moléculaire. — Armstrong, G. A., Hearst, J. E. Genetics and Molecular Biography of carotenoid pigment bio synthese. FASEB J. 10, 228-237 (1996)


Nous remercions les membres de notre laboratoire et les Drs. Foen Peng, Pam Diggle, Jeff Seemann et Qinlong Zhu pour les discussions.

Alba, R., Payton, P., Fei, Z., McQuinn, R., Debbie, P., Martin, G.B., et al. (2005). Les analyses du transcriptome et de certains métabolites révèlent plusieurs points de contrôle de l'éthylène au cours du développement du fruit de la tomate. Cellule de plante 17 (11), 2954&# x20132965. doi: 10.1105/tpc.105.036053

Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., et al. (2012). Le chemin du β-carotène à la carlactone, une hormone végétale semblable à la strigolactone. Science 335 (6074), 1348. doi : 10.1126/science.1218094

Amiour, N., Imbaud, S., Clément, G., Agier, N., Zivy, M., Valot, B., et al. (2012). L'utilisation de la métabolomique intégrée aux études transcriptomiques et protéomiques pour identifier les étapes clés impliquées dans le contrôle du métabolisme de l'azote dans les cultures telles que le maïs. J. Exp. Bot. 63 (14), 5017&# x20135033. doi: 10.1093/jxb/ers186

Ampomah-Dwamena, C., Thrimawithana, A. H., Dejnoprat, S., Lewis, D., Espley, R. V., Allan, A. C. (2019). Un kiwi (Actinidia deliciosa) Le facteur de transcription R2R3-MYB module l'accumulation de chlorophylle et de caroténoïdes. Nouveau Phytol. 221 (1), 309&# x2013325. doi: 10.1111/nph.15362

Andersson, A., Keskitalo, J., Sjádin, A., Bhalerao, R., Sterky, F., Wissel, K., et al. (2004). Un calendrier transcriptionnel de la sénescence automnale. Génome Biol. 5 (4), R24. doi: 10.1186/gb-2004-5-4-r24

Andrade, P., Caudepón, D., Altabella, T., Arró, M., Ferrer, A., Manzano, D. (2017). Interactions complexes entre les phytostérols et le développement des plastes. Comportement du signal des plantes. 12 (11), e1387708. doi: 10.1080/15592324.2017.1387708

Arango, J., Wüst, F., Beyer, P., Welsch, R. (2010). Caractérisation des phytoène synthases du manioc et leur implication dans les réponses induites par le stress abiotique. Plante 232 (5), 1251&# x20131262. doi: 10.1007/s00425-010-1250-6

Arango, J., Beltrán, J., Nu༞z, J., Chavarriaga, P. (2016). 𠇎vidence de mécanismes épigénétiques affectant les caroténoïdes,” dans Caroténoïdes dans la nature (Cham, Suisse : Springer) 295&# x2013307.

Audran, C., Borel, C., Frey, A., Sotta, B., Meyer, C., Simonneau, T., et al. (1998). Études d'expression du gène de la zéaxanthine époxydase dans Nicotiana plumbaginifolia. J. Physiol Végétal. 118 (3), 1021&# x20131028. doi: 10.1104/pp.118.3.1021

Audran, C., Liotenberg, S., Gonneau, M., North, H., Frey, A., Tap-Waksman, K., et al. (2001). Localisation et expression de l'ARNm de la zéaxanthine époxydase dans Arabidopsis en réponse au stress hydrique et pendant le développement des graines. Fonction. Biol végétale. 28 (12), 1161&# x20131173.

Auldridge, M.E., McCarty, D.R., Klee, H.J. (2006). Oxygénases de clivage des caroténoïdes végétaux et leurs produits apocaroténoïdes. Cour. Avis. Biol végétale. 9 (3), 315&# x2013321. doi: 10.1016/j.pbi.2006.03.005

Avendaño-Vázquez, A., Cordoba, E., Llamas, E., San Román, C., Nisar, N., Torre, D.L., et al. (2014). Un signal non caractérisé dérivé des apocaroténoïdes généré dans les mutants de la ζ-carotène désaturase régule le développement des feuilles et l'expression des gènes chloroplastiques et nucléaires dans Arabidopsis. Cellule de plante 26 (6), 2524�. doi: 10.1105/tpc.114.123349

Bae, G., Choi, G. (2008). Décodage des signaux lumineux par les phytochromes végétaux et leurs protéines en interaction. Annu. Rév. Plant Biol. 59 (1), 281�. doi: 10.1146/annurev.arplant.59.032607.092859

Balazadeh, S., Schildhauer, J., Arañfajo, W.L., Munná9-Bosch, S., Fernie, A.R., Proost, S., et al. (2014). Inversion de la sénescence par réapprovisionnement en N vers N-affamés Arabidopsis thaliana: conséquences transcriptomiques et métabolomiques. J. Exp. Bot. 65 (14), 3975&# x20133992. doi: 10.1093/jxb/eru119

Baroli, I., Niyogi, K.K. (2000). Génétique moléculaire de la photoprotection dépendante de la xanthophylle chez les algues vertes et les plantes. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 355 (1402), 1385&# x20131394. doi: 10.1098/rstb.2000.0700

Bartley, G.E., Scolnik, P.A. (1995). Caroténoïdes végétaux : pigments pour la photoprotection, l'attraction visuelle et la santé humaine. Cellule de plante 7 (7), 1027&# x20131038. doi: 10.1105/tpc.7.7.1027

Bemer, M., Karlova, R., Ballester, A.R., Tikunov, Y.M., Bovy, A.G., Wolters-Arts, M., et al. (2012). Les homologues de la tomate FRUITFULL TDR4/FUL1 et MBP7/FUL2 régulent les aspects indépendants de l'éthylène de la maturation des fruits. Cellule de plante 24 (11), 4437�. doi: 10.1105/tpc.112.103283

Biswal, B. (1995). Catabolisme des caroténoïdes lors de la sénescence foliaire et son contrôle par la lumière. J. Photochem. Photobiol. B, Biol. 30 (1), 3�. doi: 10.1016/1011-1344(95)07197-A

Blanchette, M., Tompa, M. (2002). Découverte d'éléments régulateurs par une méthode informatique pour l'empreinte phylogénétique. Génome Res. 12 (5), 739&# x2013748. doi: 10.1101/gr.6902

Bou-Torrent, J., Toledo-Ortiz, G., Ortiz-Alcaide, M., Cifuentes-Esquivel, N., Halliday, K. J., Martinez-Garcóxeda, J., et al. (2015). La régulation de la biosynthèse des caroténoïdes par l'ombre repose sur des sous-ensembles spécifiques de facteurs de transcription et de cofacteurs antagonistes. J. Physiol Végétal. 169 (3), 1584. doi : 10.1104/pp.15.00552

Bradshaw, H., Jr., Schemske, D. W. (2003). La substitution d'allèle à un locus de couleur de fleur produit un changement de pollinisateur chez les singes. La nature 426 (6963), 176. doi : 10.1038/nature02106

Breeze, E., Harrison, E., Mchattie, S., Hughes, L., Hickman, R., Hill, C., et al. (2011). Profilage temporel à haute résolution des transcriptions pendant Arabidopsis la sénescence des feuilles révèle une chronologie distincte des processus et de la régulation. Cellule de plante 23 (3), 873�. doi: 10.1105/tpc.111.083345

Britton, G., Young, A.J. (1989). �roténoïdes chloroplastiques : fonction, biosynthèse et effets du stress et de la sénescence,” dans Tendances de la recherche sur la photosynthèse. Eds. Biswal, U. C., Britton, G. (Inde : Agro Botanical Publishers), 303&# x2013319.

Brown, B.A., Cloix, C., Jiang, G.H., Kaiserli, E., Herzyk, P., Kliebenstein, D.J., et al. (2005). Un composant de signalisation spécifique aux UV-B– orchestre la protection UV des plantes. Proc Natl Acad Sci 102 (50), 18225&# x201318230. doi: 10.1073/pnas.0507187102

Brown, B.A., Jenkins, G.I. (2008). Les voies de signalisation UV-B avec différents profils de réponse de taux de fluence sont distinguées chez les adultes Arabidopsis tissu foliaire par exigence pour UVR8, HY5 et ​​HYH. J. Physiol Végétal. 146 (2), 576&# x2013588. doi: 10.1104/pp.107.108456

Catalá, R., Medina, J., Salinas, J. (2011). Intégration de la basse température et de la signalisation lumineuse lors de la réponse d'acclimatation au froid dans Arabidopsis. Proc. Natl. Acad. Sci. ETATS-UNIS. 108 (39), 16475. doi: 10.1073/pnas.1107161108

Cavill, R., Jennen, D., Kleinjans, J., Bried&# xe9, J. J. (2016). Intégration des données transcriptomiques et métabolomiques. Bref. Bioinformatique 17 (5), 891&# x2013901. doi: 10.1093/bib/bbv090

Cazzonelli, C.I., Cuttriss, A.J., Cossetto, S.B., Pye, W., Crisp, P., Whelan, J., et al. (2009). Régulation de la composition en caroténoïdes et de la ramification des pousses dans Arabidopsis par une histone méthyltransférase modifiant la chromatine, SDG8. Cellule de plante 21 (1), 39�. doi: 10.1105/tpc.108.063131

Cazzonelli, C.I., Pogson, B.J. (2010). Source à puits : régulation de la biosynthèse des caroténoïdes chez les plantes. Tendances Plant Sci. 15 (5), 266&# x2013274. doi: 10.1016/j.tplants.2010.02.003

Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J., Erhardt, M., et al. (2011). Les DELLA régulent la biosynthèse de la chlorophylle et des caroténoïdes pour prévenir les dommages photooxydatifs lors de la déétiolement des plantules dans Arabidopsis. Cellule de plante 23 (5), 1849. doi : 10.1105/tpc.111.085233

Chiou, C., Pan, H., Chuang, Y., Yeh, K. (2010). L'expression différentielle des gènes liés aux caroténoïdes détermine la coloration diversifiée des caroténoïdes dans les tissus floraux de Oncidium cultivars. Plante 232 (4), 937&# x2013948. doi: 10.1007/s00425-010-1222-x

Chung, M., Vrebalov, J., Alba, R., Lee, J., McQuinn, R., Chung, J., et al. (2010). Une tomate (Solanum lycopersicum) Le gène APETALA2/ERF, SlAP2a, est un régulateur négatif de la maturation des fruits. Plante J. 64 (6), 936&# x2013947. doi: 10.1111/j.1365-313X.2010.04384.x

Cloix, C., Jenkins, G.I. (2008). Interaction du composant de signalisation spécifique d'Arabidopsis UV-B– UVR8 avec la chromatine. Mol. Plante 1 (1), 118�. doi: 10.1093/mp/ssm012

Clotault, J., Peltier, D., Berruyer, R., Thomas, M., Briard, M., Geoffriau, E. (2008). Expression des gènes de biosynthèse des caroténoïdes au cours du développement de la racine de carotte. J. Exp. Bot. 59 (13), 3563&# x20133573. doi: 10.1093/jxb/ern210

Corona, V., Aracri, B., Kosturkova, G., Bartley, G.E., Pitto, L., Giorgetti, L., et al. (1996). Régulation d'un promoteur de gène de biosynthèse des caroténoïdes au cours du développement de la plante. Plante J. 9 (4), 505&# x2013512.

Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., Abrams, S.R. (2010). Acide abscissique : émergence d'un réseau central de signalisation. Annu. Rév. Plant Biol. 61, 651&# x2013679. doi: 10.1146/annurev-arplant-042809-112122

D&# x2019Andrea, L., Simon-Moya, M., Llorente, B., Llamas, E., Marro, M., Loza-Alvarez, P., et al. (2018). L'interférence avec la protéase clp altère l'accumulation de caroténoïdes pendant la maturation des fruits de la tomate. J. Exp. Bot. 69 (7), 1557&# x20131568. doi: 10.1093/jxb/erx491

Dalal, M., Chinnusamy, V., Bansal, K.C. (2010). Isolement et caractérisation fonctionnelle du promoteur de la lycopène β-cyclase (CYC-B) de Solanum habrochaïtes. BMC Végétal Biol. 10 (1), 61. doi : 10.1186/1471-2229-10-61

Dall’Osto, L., Cazzaniga, S., North, H., Marion-Poll, A., Bassi, R. (2007). Les Arabidopsis Le mutant aba4-1 révèle une fonction spécifique de la néoxanthine dans la protection contre le stress photo-oxydant. Cellule de plante 19 (3), 1048. doi: 10.1105/tpc.106.049114

Dall’Osto, L., Holt, N.E., Kaligotla, S., Fuciman, M., Cazzaniga, S., Carbonera, D., et al. (2012). La zéaxanthine protège la photosynthèse des plantes en modulant le rendement en triplet de chlorophylle dans des sous-unités d'antenne spécifiques de récolte de lumière. J. Biol. Chem. 287 (50), 41820&# x201341834. doi: 10.1074/jbc.M112.405498

Delker, C., Sonntag, L., James, G., Janitza, P., Ibañez, C., Ziermann, H., et al. (2014). La voie DET1𠄼OP1–HY5 constitue un module de signalisation polyvalent régulant la photomorphogenèse et la thermomorphogenèse des plantes. Cellule Rep. 9 (6), 1983�. doi: 10.1016/j.celrep.2014.11.043

Demmig-Adams, B., Adams, W.W., III (1996). Le rôle des caroténoïdes du cycle xanthophylle dans la protection de la photosynthèse. Tendances Plant Sci. 1 (1), 21�. doi: 10.1016/S1360-1385(96)80019-7

Dong, J., Tang, D., Gao, Z., Yu, R., Li, K., He, H., et al. (2014). Arabidopsis DE-ETIOLATED1 réprime la photomorphogenèse en régulant positivement les facteurs interagissant avec les phytochromes dans l'obscurité. Cellule de plante 26 (9), 3630. doi: 10.1105/tpc.114.130666

Dong, T., Hu, Z., Deng, L., Wang, Y., Zhu, M., Zhang, J., et al. (2013). Un facteur de transcription MADS-box de tomate, SlMADS1, agit comme un régulateur négatif de la maturation des fruits. J. Physiol Végétal. 163 (2), 1026&# x20131036. doi: 10.1104/pp.113.224436

Dudareva, N., Negre, F., Nagegowda, D.A., Orlova, I. (2006). Plantes volatiles : avancées récentes et perspectives d'avenir. Critique. Rév. Plant Sci. 25 (5), 417&# x2013440. doi: 10.1080/07352680600899973

Emiliani, J., D&# x2019Andrea, L., Ferreyra, M. L. F., Mauli&# xf3n, E., Rodriguez, E., Rodriguez-Concepci&# xf3n, M., et al. (2018). Un rôle pour les β, β-xanthophylles dans Arabidopsis Photoprotection UV-B. J. Exp. Bot. 69 (20), 4921&# x20134933. doi: 10.1093/jxb/ery242

Enfissi, E. M. A., Nogueira, M., Bramley, P. M., Fraser, P. D. (2017). La régulation de la formation de caroténoïdes dans le fruit de la tomate. Plante J. 89 (4), 774&# x2013788. doi: 10.1111/tpj.13428

Eriksson, E.M., Bovy, A., Manning, K., Harrison, L., Andrews, J., De Silva, J., et al. (2004). Effet de la mutation incolore non mûrissante sur la biochimie de la paroi cellulaire et l'expression des gènes au cours du développement et de la maturation des fruits de la tomate. J. Physiol Végétal. 136 (4), 4184&# x20134197. doi: 10.1104/pp.104.045765

Favory, J.J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., et al. (2009). L'interaction de COP1 et UVR8 régule la photomorphogenèse induite par les UV-B et l'acclimatation au stress dans Arabidopsis. EMBO J. 28 (5), 591&# x2013601. doi: 10.1038/emboj.2009.4

Frank, H.A., Cogdell, R.J. (1996). Caroténoïdes dans la photosynthèse. Photochem. Photobiol. 63 (3), 257�. doi: 10.1111/j.1751-1097.1996.tb03022.x

Fraser, P.D., Truesdale, M.R., Bird, C.R., Schuch, W., Bramley, P.M. (1994). Biosynthèse des caroténoïdes au cours du développement du fruit de la tomate (preuve de l'expression de gènes spécifiques aux tissus). J. Physiol Végétal. 105 (1), 405�. doi: 10.1104/pp.105.1.405

Fu, C., Han, Y., Fan, Z., Chen, J., Chen, W., Lu, W., et al. (2016). Le facteur de transcription de la papaye CpNAC1 module la biosynthèse des caroténoïdes en activant les gènes de la phytoène désaturase CpPDS2/4 pendant la maturation des fruits. J. Agric. Chimie alimentaire. 64 (27), 5454�. doi: 10.1021/acs.jafc.6b01020

Fu, C., Han, Y., Kuang, J., Chen, J., Lu, W. (2017). La papaye CpEIN3a et CpNAC2 régulent de manière coopérative les gènes liés à la biosynthèse des caroténoïdes CpPDS2/4, CpLCY-e et CpCHY-b pendant la maturation des fruits. Cellule végétale Physiol. 58 (12), 2155�. doi: 10.1093/pcp/pcx149

Fuentes, P., Pizarro, L., Moreno, J.C., Handford, M., Rodriguez-Concepcion, M., Stange, C. (2012). Les changements dépendants de la lumière dans la différenciation des plastes influencent l'expression et l'accumulation des gènes caroténoïdes dans les racines de carotte. Plante Mol. Biol. 79 (1𠄲), 47�. doi: 10.1007/s11103-012-9893-2

Fujisawa, M., Nakano, T., Ito, Y. (2011). Identification de gènes cibles potentiels pour le régulateur de maturation des fruits de la tomate RIN par immunoprécipitation de la chromatine. BMC Végétal Biol. 11 (1), 26. doi : 10.1186/1471-2229-11-26

Fujisawa, M., Shima, Y., Higuchi, N., Nakano, T., Koyama, Y., Kasumi, T., et al. (2012). Cibles directes du régulateur de maturation de la tomate RIN identifiées par des analyses d'immunoprécipitation du transcriptome et de la chromatine. Plante 235 (6), 1107&# x20131122. doi: 10.1007/s00425-011-1561-2

Fujisawa, M., Nakano, T., Shima, Y., Ito, Y. (2013). Une identification à grande échelle de cibles directes du facteur de transcription MADS box de la tomate RIPENING INHIBITOR révèle la régulation de la maturation des fruits. Cellule de plante 25 (2), 371�. doi: 10.1105/tpc.112.108118

Fujisawa, M., Shima, Y., Nakagawa, H., Kitagawa, M., Kimbara, J., Nakano, T., et al. (2014). Régulation transcriptionnelle de la maturation des fruits par les homologues FRUITFULL de la tomate et les protéines de la boîte MADS associées. Cellule de plante 26 (1), 89�. doi: 10.1105/tpc.113.119453

Galpaz, N., Ronen, G., Khalfa, Z., Zamir, D., Hirschberg, J. (2006). Une voie de biosynthèse des caroténoïdes spécifique au chromoplaste est révélée par le clonage du locus de la fleur blanche de la tomate. Cellule de plante 18 (8), 1947&# x20131960. doi: 10.1105/tpc.105.039966

Gan, S., Amasino, R.M. (1997). Donner du sens à la sénescence (régulation génétique moléculaire et manipulation de la sénescence des feuilles). J. Physiol Végétal. 113 (2), 313. doi : 10.1104/pp.113.2.313

Gandikota, M., Birkenbihl, R. P., H&xf6hmann, S., Cardon, G. H., Saedler, H., Huijser, P. (2007). L'élément de reconnaissance miRNA156/157 dans le 3′ UTR du Arabidopsis Le gène de la boîte SBP SPL3 empêche la floraison précoce par inhibition de la traduction chez les plantules. Plante J. 49 (4), 683�. doi: 10.1111/j.1365-313X.2006.02983.x

Giménez, E., Pineda, B., Capel, J., Antón, M.T., Atarés, A., Pérez-Martín, F., et al. (2010). L'analyse fonctionnelle du mutant Arlequin corrobore le rôle essentiel du gène Arlequin/TAGL1 au cours du développement reproducteur de la tomate. PLoS Un 5 (12), e14427. doi: 10.1371/journal.pone.0014427

Giovannoni, J.J. (2007). Les mutants de maturation des fruits donnent des informations sur le contrôle de la maturation. Cour. Avis. Biol végétale. 10 (3), 283�. doi: 10.1016/j.pbi.2007.04.008

Giovannoni, J., Nguyen, C., Ampofo, B., Zhong, S., Fei, Z. (2017). L'épigénome et la dynamique transcriptionnelle de la maturation des fruits. Annu. Rév. Plant Biol. 68, 61�.

Giuliano, G., Bartley, G.E., Scolnik, P.A. (1993). Régulation de la biosynthèse des caroténoïdes au cours du développement de la tomate. Cellule de plante 5 (4), 379�. doi: 10.1105/tpc.5.4.379

Goodwin, T., Britton, G.W. (1988). 𠇍istribution et analyse des caroténoïdes,” dans les pigments végétaux. Éd. Goodwin, T. W. (Londres : Academic Press), 62&# x2013132.

Grassi, S., Piro, G., Lee, J.M., Zheng, Y., Fei, Z., Dalessandro, G., et al. (2013). La génomique comparative révèle des régulateurs candidats de la voie des caroténoïdes de la maturation des fruits de la pastèque. BMC Génomique 14 (1), 781. doi : 10.1186/1471-2164-14-781

Guo, J., Hu, Z., Yu, X., Li, A., Li, F., Wang, Y., et al. (2018). Un gène d'histone désacétylase, SlHDA3, agit comme un régulateur négatif de la maturation des fruits et de l'accumulation de caroténoïdes. Rép. Cellulaire Végétale 37 (1), 125�. doi: 10.1007/s00299-017-2211-3

Ha, S., Kim, J., Park, J., Lee, S., Cho, K. (2007). Une comparaison de l'accumulation de caroténoïdes dans des variétés de capsicum qui présentent différentes couleurs de maturation : la délétion du gène de la capsanthine/capsorubine synthase n'est pas une condition préalable à la formation d'un poivron jaune. J. Exp. Bot. 58 (12), 3135�. doi: 10.1093/jxb/erm132

Hao, Y., Hu, G., Breitel, D., Liu, M., Mila, I., Frasse, P., et al. (2015). Le facteur de réponse à l'auxine SlARF2 est une composante essentielle du mécanisme de régulation contrôlant la maturation des fruits chez la tomate. Génétique PLoS 11 (12), e1005649. doi: 10.1371/journal.pgen.1005649

Hashimoto, H., Uragami, C., Cogdell, R. J. (2016). �roténoïdes et photosynthèse,” dans Caroténoïdes dans la nature (Cham, Suisse : Springer), 111&# x2013139.

Havaux, M. (1998). Les caroténoïdes comme stabilisants membranaires dans les chloroplastes. Tendances Plant Sci. 3 (4), 147�. doi: 10.1016/S1360-1385(98)01200-X

Helmy, M., Crits-Christoph, A., Bader, G.D. (2016). Dix règles simples pour développer des bases de données biologiques publiques. Calcul PLoS. Biol. 12 (11), e1005128. doi: 10.1371/journal.pcbi.1005128

Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T. (1999). Base de données des éléments d'ADN régulateurs agissant en cis des plantes (PLACE) : 1999. Acides nucléiques Res. 27 (1), 297�. doi: 10.1093/nar/27.1.297

Hirschberg, J. (2001).Biosynthèse des caroténoïdes chez les plantes à fleurs. Cour. Avis. Biol végétale. 4 (3), 210&# x2013218. doi: 10.1016/S1369-5266(00)00163-1

Hou, X., Rivers, J., León, P., McQuinn, R. P., Pogson, B. J. (2016). Synthèse et fonction des signaux apocaroténoïdes chez les plantes. Tendances Plant Sci. 21 (9), 792�. doi: 10.1016/j.tplants.2016.06.001

Howitt, C.A., Pogson, B.J. (2006). Accumulation et fonction des caroténoïdes dans les graines et les tissus non verts. Environ de cellules végétales. 29 (3), 435&# x2013445. doi: 10.1111/j.1365-3040.2005.01492.x

Itkin, M., Seybold, H., Breitel, D., Rogachev, I., Meir, S., Aharoni, A. (2009). TOMATE AGAMOUS-LIKE 1 est une composante du réseau de régulation de la maturation des fruits. Plante J. 60 (6), 1081�. doi: 10.1111/j.1365-313X.2009.04064.x

Ito, Y., Kitagawa, M., Ihashi, N., Yabe, K., Kimbara, J., Yasuda, J., et al. (2008). Spécificité de liaison à l'ADN, potentiel d'activation transcriptionnelle et effet de mutation rin pour le régulateur de maturation des fruits de la tomate RIN. Plante J. 55 (2), 212�. doi: 10.1111/j.1365-313X.2008.03491.x

Jahns, P., Holzwarth, A.R. (2012). Le rôle du cycle xanthophylle et de la lutéine dans la photoprotection du photosystème II. BBA-Bioénergétique 1817 (1), 182&# x2013193. doi: 10.1016/j.bbabio.2011.04.012

Jia, K., Baz, L., Al-Babili, S. (2017). Des caroténoïdes aux strigolactones. J. Exp. Bot. 69 (9), 2189&# x20132204. doi: 10.1093/jxb/erx476

Jiao, Y., Lau, O.S., Deng, X.W. (2007). Réseaux transcriptionnels régulés par la lumière dans les plantes supérieures. Nat. le révérend Genet. 8 (3), 217. doi : 10.1038/nrg2049

Jin, X., Bai, C., Bassie, L., Nogareda, C., Romagosa, I., Twyman, R. M., et al. (2019). Les facteurs de transcription ZmPBF et ZmGAMYB transactivent indépendamment le promoteur du maïs (Zea mays) gène β-carotène hydroxylase 2. Nouveau Phytol. 222 (2), 793&# x2013804. doi: 10.1111/nph.15614

Karlova, R., Rosin, F.M., Busscher-Lange, J., Parapunova, V., Do, P.T., Fernie, A.R., et al. (2011). Le profilage du transcriptome et des métabolites montre qu'APETALA2a est un régulateur majeur de la maturation des fruits de la tomate. Cellule de plante 23 (3), 923&# x2013941. doi: 10.1105/tpc.110.081273

Kim, D.H., Yamaguchi, S., Lim, S., Oh, E., Park, J., Hanada, A., et al. (2008). SOMNUS, une protéine à doigt de zinc de type CCCH dans Arabidopsis, régule négativement la germination des graines dépendante de la lumière en aval de PIL5. Cellule de plante 20 (5), 1260&# x20131277. doi: 10.1105/tpc.108.058859

Kim, J., Kang, H., Park, J., Kim, W., Yoo, J., Lee, N., et al. (2016). Les facteurs de transcription interagissant avec PIF1 et leurs éléments de séquence de liaison déterminent la in vivo ciblant les sites de PIF1. Cellule de plante 28 (6), 1388�. doi: 10.1105/tpc.16.00125

Kishimoto, S., Oda-Yamamizo, C., Ohmiya, A. (2018). Régulation de la pigmentation caroténoïde des corolles de pétunia. Plante Mol. Biol. représentant 36 (4), 632&# x2013642. doi: 10.1007/s11105-018-1107-x

Klee, H.J., Giovannoni, J.J. (2011). Génétique et contrôle de la maturation des fruits de la tomate et des attributs de qualité. Annu. le révérend Genet. 45 (1), 41�. doi: 10.1146/annurev-genet-110410-132507

Kolotilin, I., Koltai, H., Tadmor, Y., Bar-Or, C., Reuveni, M., Meir, A., et al. (2007). Le profilage transcriptionnel du mutant de tomate à haute teneur en pigment-2 dg relie la biogenèse précoce des plastes des fruits à sa surproduction de phytonutriments. J. Physiol Végétal. 145 (2), 389&# x2013401. doi: 10.1104/pp.107.102962

Kramer, E.M. (2015). Un étranger dans un pays étranger : l'utilité et l'interprétation de l'expression hétérologue. Devant. Plante Sci. 6, 734. doi: 10.3389/fpls.2015.00734

Lau, O.S., Deng, X.W. (2012). Les répresseurs photomorphogéniques COP1 et DET1 : 20 ans après. Tendances Plant Sci. 17 (10), 584�. doi: 10.1016/j.tplants.2012.05.004

Larsen, P.E., Sreedasyam, A., Trivedi, G., Desai, S., Dai, Y., Cseke, L.J., et al. (2016). L'approche multi-omique identifie les mécanismes moléculaires de l'interaction mycorhizienne entre les plantes et les champignons. Devant. Plante Sci. 6, 1061. doi : 10.3389/fpls.2015.01061

Lescot, M., Déhais, P., Thijs, G., Marchal, K., Moreau, Y., de Peer, Y., et al. (2002). PlantCARE, une base de données d'éléments régulateurs agissant en cis des plantes et un portail vers des outils pour l'analyse in silico des séquences promotrices. Acides nucléiques Res. 30 (1), 325�. doi: 10.1093/nar/30.1.325

Levin, I., Frankel, P., Gilboa, N., Tanny, S., Lalazar, A. (2003). La mutation vert foncé de la tomate est un nouvel allèle de l'homologue tomate du gène DEETIOLATED1. Théor. Appl. Genet. 106 (3), 454�. doi: 10.1007/s00122-002-1080-4

Li, F., Vallabhaneni, R., Yu, J., Rocheford, T., Wurtzel, E.T. (2008a). La famille des gènes de la phytoène synthase du maïs : rôles qui se chevauchent pour la caroténogenèse dans l'endosperme, la photomorphogenèse et la tolérance au stress thermique. J. Physiol Végétal. 147 (3), 1334&# x20131346. doi: 10.1104/pp.108.122119

Li, F., Vallabhaneni, R., Wurtzel, E. T. (2008b). PSY3, un nouveau membre de la famille des gènes de la phytoène synthase conservée chez les Poacées et régulateur de la caroténogenèse racinaire induite par le stress abiotique. J. Physiol Végétal. 146 (3), 1333&# x20131345. doi: 10.1104/pp.107.111120

Li, L., Yuan, H., Zeng, Y., Xu, Q. (2016). &# x201cPlastides et accumulation de caroténoïdes,&# x201d dans Caroténoïdes dans la nature (Cham, Suisse : Springer), 273&# x2013293.

Li, S., Chen, K., Grierson, D. (2019). Une évaluation critique du rôle des facteurs de transcription éthylène et MADS dans le réseau contrôlant la maturation des fruits charnus. Nouveau Phytol. 221 (4), 1724&# x20131741. doi: 10.1111/nph.15545

Lieberman, M., Segev, O., Gilboa, N., Lalazar, A., Levin, I. (2004). L'homologue de tomate du gène codant pour la protéine de liaison à l'ADN endommagée par les UV 1 (DDB1) a été souligné comme étant le gène à l'origine du phénotype mutant à pigment-1 élevé. Théor. Appl. Genet. 108 (8), 1574&# x20131581. doi: 10.1007/s00122-004-1584-1

Lim, P.O., Kim, H.J., Gil Nam, H. (2007). Sénescence des feuilles. Annu. Rév. Plant Biol. 58, 115�. doi: 10.1146/annurev.arplant.57.032905.105316

Lin, Z., Hong, Y., Yin, M., Li, C., Zhang, K., Grierson, D. (2008). Une protéine homéoboîte HD-Zip de tomate, LeHB-1, joue un rôle important dans l'organogenèse florale et la maturation. Plante J. 55 (2), 301�. doi: 10.1111/j.1365-313X.2008.03505.x

Liu, G., Ren, G., Guirgis, A., Thornburg, R. W. (2009). Le facteur de transcription MYB305 régule l'expression des gènes de la nectarine dans le nectaire floral du tabac ornemental. Cellule de plante 21 (9), 2672&# x20132687. doi: 10.1105/tpc.108.060079

Liu, L., Jia, C., Zhang, M., Chen, D., Chen, S., Guo, R., et al. (2014). L'expression ectopique d'un facteur de transcription BZR1-1D dans la signalisation des brassinostéroïdes améliore l'accumulation de caroténoïdes et les attributs de qualité des fruits chez la tomate. Biotechnologie végétale. J. 12 (1), 105�. doi: 10.1111/pbi.12121

Liu, L., Wei, J., Zhang, M., Zhang, L., Li, C., Wang, Q. (2012). Induction indépendante de l'éthylène de la biosynthèse du lycopène dans les tomates par les jasmonates. J. Exp. Bot. 63 (16), 5751&# x20135761. doi: 10.1093/jxb/ers224

Liu, L., Shao, Z., Zhang, M., Wang, Q. (2015a). Régulation du métabolisme des caroténoïdes chez la tomate. Mol. Plante 8 (1), 28�. doi: 10.1016/j.molp.2014.11.006

Liu, M., Pirrello, J., Chervin, C., Roustan, J., Bouzayen, M. (2015b). Contrôle éthylène de la maturation des fruits : revisiter le réseau complexe de régulation transcriptionnelle. J. Physiol Végétal. 169 (4), 2380. doi : 10.1104/pp.15.01361

Liu, X., Zhang, Y., Chen, Y., Li, M., Zhou, F., Li, K., et al. (2017). Capture in situ des interactions de la chromatine par dCas9 biotinylé. Cellule 170 (5), 1028&# x20131043. doi: 10.1016/j.cell.2017.08.003

Llorente, B., D&# x2019andrea, L., Ruiz-Sola, M. A., Botterweg, E., Pulido, P., Andilla, J., et al. (2016). La biosynthèse des caroténoïdes de la tomate est ajustée à la progression réelle de la maturation par un mécanisme dépendant de la lumière. Plante J. 85 (1), 107�. doi: 10.1111/tpj.13094

Llorente, B., Martinez-Garcia, J., Stange, C., Rodriguez-Concepcion, M. (2017). Couleurs lumineuses : régulation de la biosynthèse et de l'accumulation des caroténoïdes par la lumière. Cour. Avis. Biol végétale. 37, 49�. doi: 10.1016/j.pbi.2017.03.011

López-Rพz, J.A., Charnikhova, T., Gómez-Roldán, V., Matusova, R., Kohlen, W., De Vos, R., et al. (2008). Les strigolactones de la tomate sont dérivées des caroténoïdes et leur biosynthèse est favorisée par la privation de phosphate. Nouveau Phytol. 178 (4), 863&# x2013874. doi: 10.1111/j.1469-8137.2008.02406.x

Lu, S., Van Eck, J., Zhou, X., Lopez, A. B., O’Halloran, D. M., Cosman, K. M., et al. (2006). Le chou-fleur ou le gène code pour une protéine contenant un domaine riche en cystéine DnaJ qui médie des niveaux élevés d'accumulation de bêta-carotène. Cellule de plante 18 (12), 3594&# x20133605. doi: 10.1105/tpc.106.046417

Lu, S., Zhang, Y., Zhu, K., Yang, W., Ye, J., Chai, L., et al. (2018). Le facteur de transcription des agrumes CsMADS6 module le métabolisme des caroténoïdes en régulant directement les gènes caroténogènes. J. Physiol Végétal. 176 (4), 2657&# x20132676. doi: 10.1104/pp.17.01830

Luo, Z., Zhang, J., Li, J., Yang, C., Wang, T., Ouyang, B., et al. (2013). Une protéine STAY-GREEN SlSGR1 régule l'accumulation de lycopène et de β-carotène en interagissant directement avec SlPSY1 pendant les processus de maturation de la tomate. Nouveau Phytol. 198 (2), 442&# x2013452. doi: 10.1111/nph.12175

Ma, N., Feng, H., Meng, X., Li, D., Yang, D., Wu, C., et al. (2014). La surexpression du facteur de transcription SlNAC1 de la tomate altère la pigmentation et le ramollissement des fruits. BMC Végétal Biol. 14 (1), 351. doi : 10.1186/s12870-014-0351-y

Maass, D., Arango, J., Wüst, F., Beyer, P., Welsch, R. (2009). Formation de cristaux de caroténoïdes dans Arabidopsis et les racines de carotte causées par l'augmentation des niveaux de protéines de phytoène synthase. PloS Un 4 (7), e6373. doi: 10.1371/journal.pone.0006373

Manning, K., Tör, M., Poole, M., Hong, Y., Thompson, A.J., King, G.J., et al. (2006). Une mutation épigénétique naturelle dans un gène codant pour un facteur de transcription SBP-box inhibe la maturation des fruits de la tomate. Nat. Genet. 38 (8), 948. doi : 10.1038/ng1841

Martel, C., Vrebalov, J., Tafelmeyer, P., Giovannoni, J. J. (2011). Le facteur de transcription MADS-box de la tomate RIPENING INHIBITOR interagit avec les promoteurs impliqués dans de nombreux processus de maturation d'une manière INCOLORE NON RIPENING�pendent. J. Physiol Végétal. 157 (3), 1568. doi : 10.1104/pp.111.181107

Maruyama, K., Urano, K., Yoshiwara, K., Morishita, Y., Sakurai, N., Suzuki, H., et al. (2014). Analyse intégrée des effets du froid et de la déshydratation sur les métabolites, les phytohormones et les transcrits génétiques du riz. J. Physiol Végétal. 164 (4), 1759&# x20131771. doi: 10.1104/pp.113.231720

Meier, S., Tzfadia, O., Vallabhaneni, R., Gehring, C., Wurtzel, E. T. (2011). Une analyse transcriptionnelle des gènes de biosynthèse des caroténoïdes, de la chlorophylle et des isoprénoïdes plastidiaux au cours du développement et des réponses au stress osmotique chez Arabidopsis thaliana. Système BMC. Biol. 5 (1), 77. doi : 10.1186/1752-0509-5-77

Meng, C., Yang, D., Ma, X., Zhao, W., Liang, X., Ma, N., et al. (2016). La suppression du facteur de transcription SlNAC1 de la tomate retarde la maturation des fruits. J. Physiol Végétal. 193, 88&# x201396. doi: 10.1016/j.jplph.2016.01.014

Middleton, E.M., Teramura, A.H. (1993). Le rôle des glycosides de flavonol et des caroténoïdes dans la protection du soja contre les dommages causés par les ultraviolets B. J. Physiol Végétal. 103 (3), 741�. doi: 10.1104/pp.103.3.741

Mochida, K., Shinozaki, K. (2011). Avancées des outils omiques et bioinformatiques pour l'analyse systémique des fonctions végétales. Cellule végétale Physiol. 52 (12), 2017�. doi: 10.1093/pcp/pcr153

Moehs, C.P., Tian, ​​L., Osteryoung, K.W., DellaPenna, D. (2001). Analyse de l'expression des gènes de biosynthèse des caroténoïdes au cours du développement des pétales de souci. Plante Mol. Biol. 45 (3), 281&# x2013293. doi: 10.1023/A:1006417009203

Moon, J., Zhu, L., Shen, H., Huq, E. (2008). PIF1 régule directement et indirectement la biosynthèse de la chlorophylle pour optimiser le processus de verdissement dans Arabidopsis. Proc. Natl. Acad. Sci. ETATS-UNIS. 105 (27), 9433. doi: 10.1073/pnas.0803611105

Mou, W., Li, D., Bu, J., Jiang, Y., Khan, Z. U., Luo, Z., et al. (2016). Analyse complète des effets de l'ABA sur la biosynthèse et la signalisation de l'éthylène pendant la maturation des fruits de la tomate. PLoS Un 11 (4), e0154072. doi: 10.1371/journal.pone.0154072

Müller, P., Li, X.P., Niyogi, K.K. (2001). Trempe non photochimique. Une réponse à l'excès d'énergie lumineuse. J. Physiol Végétal. 125 (4), 1558&# x20131566. doi: 10.1104/pp.125.4.1558

Mustilli, A.C., Fenzi, F., Ciliento, R., Alfano, F., Bowler, C. (1999). Le phénotype du mutant tomate high pigment-2 est causé par une mutation dans l'homologue de la tomate DEETIOLATED1. Cellule de plante 11 (2), 145&# x2013157. doi: 10.1105/tpc.11.2.145

Nambara, E., Marion-Poll, A. (2005). Biosynthèse et catabolisme de l'acide abscissique. Annu. Rév. Plant Biol. 56, 165�. doi: 10.1146/annurev.arplant.56.032604.144046

Nielsen, J., Keasling, J. D. (2016). Ingénierie du métabolisme cellulaire. Cellule 164 (6), 1185&# x20131197. doi: 10.1016/j.cell.2016.02.004

Nielsen, K.M., Lewis, D.H., Morgan, E.R. (2003). Caractérisation des pigments caroténoïdes et leur biosynthèse dans deux lignées à fleurs jaunes Sandersonia aurantiaca (Accrocher). Euphytique 130 (1), 25�. doi: 10.1023/A:1022328828688

Nisar, N., Li, L., Lu, S., Khin, N., Pogson, B. (2015). Métabolisme des caroténoïdes chez les plantes. Mol. Plante 8 (1), 68�. doi: 10.1016/j.molp.2014.12.007

Niyogi, K.K. (1999). Photoprotection revisitée : Approches génétiques et moléculaires. Annu. Rév. Plant Biol. 50 (1), 333�. doi: 10.1146/annurev.arplant.50.1.333

Oh, E., Kang, H., Yamaguchi, S., Park, J., Lee, D., Kamiya, Y., et al. (2009). Analyse à l'échelle du génome des gènes ciblés par PHYTOCHROME INTERACTING FACTOR 3-LIKE5 pendant la germination des graines dans Arabidopsis. Cellule de plante 21 (2), 403&# x2013419. doi: 10.1105/tpc.108.064691

Ohmiya, A., Kishimoto, S., Aida, R., Yoshioka, S., Sumitomo, K. (2006). La dioxygénase de clivage des caroténoïdes (CmCCD4a) contribue à la formation de couleur blanche dans les pétales de chrysanthème. J. Physiol Végétal. 142 (3), 1193&# x20131201. doi: 10.1104/pp.106.087130

Ohmiya, A. (2011). Diversité de la composition en caroténoïdes des pétales de fleurs. Japon. Agric. Rés. Q. 45 (2), 163&# x2013171. doi: 10.6090/jarq.45.163

Ohmiya, A. (2013). Contrôle qualitatif et quantitatif de l'accumulation de caroténoïdes dans les pétales de fleurs. Sci. Hortique. 163, 10�. doi: 10.1016/j.scienta.2013.06.018

Ohmiya, A., Kato, M., Shimada, T., Nashima, K., Kishimoto, S., Nagata, M. (2019). Base moléculaire de l'accumulation de caroténoïdes dans les cultures horticoles. Hortique. J. 88 (2), 135�. doi: 10.2503/hortj.UTD-R003

Ougham, H.J., Morris, P., Thomas, H. (2005). Les couleurs des feuilles d'automne comme symptômes du recyclage cellulaire et des défenses contre les stress environnementaux. Cour. Sommet. Dév. Biol. 66, 136&# x2013161.

Pecker, I., Chamovitz, D., Linden, H., Sandmann, G., Hirschberg, J. (1992). Un seul polypeptide catalysant la conversion du phytoène en zêta-carotène est régulé par la transcription au cours de la maturation des fruits de la tomate. Proc. Natl. Acad. Sci. ETATS-UNIS. 89 (11), 4962�. doi: 10.1073/pnas.89.11.4962

Pfeiffer, A., Shi, H., Tepperman, J. M., Zhang, Y., Quail, P. H. (2014). Complexité combinatoire dans un hub de signalisation centré sur la transcription dans Arabidopsis. Mol. Plante 7 (11), 1598&# x20131618. doi: 10.1093/mp/ssu087

Pogson, B.J., Niyogi, K.K., Bjorkman, O., Dellapenna, D. (1998). Les compositions modifiées de la xanthophylle affectent négativement l'accumulation de chlorophylle et l'extinction non photochimique dans Arabidopsis mutants. Proc. Natl. Acad. Sci. 95 (22), 13324&# x201313329. doi: 10.1073/pnas.95.22.13324

Posp&# xé&# x161il, P. (2016). Production d'espèces réactives de l'oxygène par le photosystème II en réponse à un stress lumineux et thermique. Devant. Plante Sci. 7, 1950. doi: 10.3389/fpls.2016.01950

Qin, G., Wang, Y., Cao, B., Wang, W., Tian, ​​S. (2012). Démêler le réseau de régulation du facteur de transcription MADS box RIN dans la maturation des fruits. Plante J. 70 (2), 243�. doi: 10.1111/j.1365-313X.2011.04861.x

Rai, A., Saito, K., Yamazaki, M. (2017). Analyse omique intégrée du métabolisme spécialisé des plantes médicinales. Plante J. 90 (4), 764�. doi: 10.1111/tpj.13485

Rizzini, L., Favory, J. J., Cloix, C., Faggionato, D., O’Hara, A., Kaiserli, E., et al. (2011). Perception des UV-B par le Arabidopsis Protéine UVR8. Science 332 (6025), 103&# x2013106. doi: 10.1126/science.1200660

Rock, C.D., Zeevaart, J.A. (1991). Le mutant aba de Arabidopsis thaliana est altérée dans la biosynthèse des époxy-caroténoïdes. Proc. Natl. Acad. Sci. ETATS-UNIS. 88 (17), 7496&# x20137499. doi: 10.1073/pnas.88.17.7496

Rodráxedguez-Leal, D., Lemmon, Z. H., Man, J., Bartlett, M. E., Lippman, Z. B. (2017). Ingénierie de la variation des caractères quantitatifs pour l'amélioration des cultures par édition du génome. Cellule 171 (2), 470&# x2013480. doi: 10.1016/j.cell.2017.08.030

Rodríguez-Villalón, A., Gas, E., Rodríguez-Concepción, M. (2009).L'activité de la phytoène synthase contrôle la biosynthèse des caroténoïdes et l'approvisionnement de leurs précurseurs métaboliques dans l'obscurité Arabidopsis semis. Plante J. 60 (3), 424�. doi: 10.1111/j.1365-313X.2009.03966.x

Ronen, G., Cohen, M., Zamir, D., Hirschberg, J. (1999). Régulation de la biosynthèse des caroténoïdes au cours du développement du fruit de la tomate : l'expression du gène de la lycopène epsilon-cyclase est régulée à la baisse pendant la maturation et est élevée dans le delta mutant. Plante J. 17 (4), 341&# x2013351. doi: 10.1046/j.1365-313X.1999.00381.x

Rossel, J.B., Wilson, I.W., Pogson, B.J. (2002). Changements globaux dans l'expression des gènes en réponse à une forte luminosité dans Arabidopsis. J. Physiol Végétal. 130 (3), 1109&# x20131120. doi: 10.1104/pp.005595

Ruiz-Sola, M., Arbona, V., G&# xf3mez-Cadenas, A., Rodr&# xedguez-Concepci&# xf3n, M., Rodr&# xedguez-Villal&# xf3n, A. (2014). Une induction spécifique de la racine de la biosynthèse des caroténoïdes contribue à la production d'ABA lors du stress salin dans Arabidopsis. PLoS Un 9 (3), e90765. doi: 10.1371/journal.pone.0090765

Ruiz-Sola, M. A., Rodr&# xedguez-Concepci&# xf3n, M. (2012). Biosynthèse des caroténoïdes dans Arabidopsis: un chemin coloré. Livre Arabidopsis 10, e0158. doi: 10.1199/tab.0158

Sagawa, J. M., Stanley, L. E., LaFountain, A. M., Frank, H. A., Liu, C., Yuan, Y. (2016). Un facteur de transcription R2R3-MYB régule la pigmentation des caroténoïdes dans Mimulus lewisii fleurs. Nouveau Phytol. 209 (3), 1049&# x20131057. doi: 10.1111/nph.13647

Sakakibara, H. (2006). Cytokinines : activité, biosynthèse et translocation. Annu. Rév. Plant Biol. 57, 431&# x2013449. doi: 10.1146/annurev.arplant.57.032905.105231

Shen, H., Zhu, L., Castillon, A., Majee, M., Downie, B., Huq, E. (2008). Phosphorylation induite par la lumière et dégradation du régulateur négatif PHYTOCHROME-INTERACTING FACTOR1 de Arabidopsis dépendent de ses interactions physiques directes avec les phytochromes photoactivés. Cellule de plante 20 (6), 1586. doi : 10.1105/tpc.108.060020

Shi, H., Wang, X., Mo, X., Tang, C., Zhong, S., Deng, X. W. (2015). Arabidopsis DET1 dégrade HFR1 mais stabilise PIF1 pour réguler précisément la germination des graines. Proc. Natl. Acad. Sci. ETATS-UNIS. 112 (12), 3817. doi : 10.1073/pnas.1502405112

Shima, Y., Kitagawa, M., Fujisawa, M., Nakano, T., Kato, H., Kimbara, J., et al. (2013). Les homologues de la tomate FRUITFULL agissent sur la maturation des fruits passant par formant des complexes de facteur de transcription MADS-box avec RIN. Plante Mol. Biol. 82 (4-5), 427&# x2013438. doi: 10.1007/s11103-013-0071-y

Shin, J., Kim, K., Kang, H., Zulfugarov, I.S., Bae, G., Lee, C., et al. (2009). Les phytochromes favorisent les réponses lumineuses des semis en inhibant quatre facteurs interagissant négativement avec les phytochromes. Proc. Natl. Acad. Sci. ETATS-UNIS. 106 (18), 7660. doi: 10.1073/pnas.0812219106

Shinozaki, K., Yamaguchi-Shinozaki, K. (2007). Réseaux de gènes impliqués dans la réponse et la tolérance au stress hydrique. J. Exp. Bot. 58 (2), 221�. doi: 10.1093/jxb/erl164

Snowden, K.C., Simkin, A.J., Janssen, B.J., Templeton, K.R., Loucas, H.M., Simons, J.L., et al. (2005). La diminution de la dominance apicale1/Pétunia hybrida Le gène DIOXYGENASE8 du clivage des caroténoïdes affecte la production de branches et joue un rôle dans la sénescence des feuilles, la croissance des racines et le développement des fleurs. Cellule de plante 17 (3), 746. doi : 10.1105/tpc.104.027714

Stanley, L.E., Ding, B., Sun, W., Mou, F., Hill, C., Chen, S., et al. (2017). Une protéine à répétition tétratricopeptide régule la biosynthèse des caroténoïdes et le développement des chromoplastes chez les fleurs de singe (Mimule). Biorxiv 171249. doi : 10.1101/171249

Su, L., Diretto, G., Purgatto, E., Danoun, S., Zouine, M., Li, Z., et al. (2015). L'accumulation de caroténoïdes pendant la maturation des fruits de la tomate est modulée par l'équilibre de l'auxine et de l'éthylène. BMC Végétal Biol. 15 (1), 114. doi : 10.1186/s12870-015-0495-4

Sun, T., Yuan, H., Cao, H., Yazdani, M., Tadmor, Y., Li, L. (2018a). Métabolisme des caroténoïdes chez les plantes : le rôle des plastes. Mol. Plante 11 (1), 58�. doi: 10.1016/j.molp.2017.09.010

Sun, Y., Liang, B., Wang, J., Kai, W., Chen, P., Jiang, L., et al. (2018b). SlPti4 affecte la régulation de la maturation des fruits, la germination des graines et les réponses au stress en modulant la signalisation ABA chez la tomate. Cellule végétale Physiol. 59 (10), 1956&# x20131965. doi: 10.1093/pcp/pcy111

Szymańska, R., Ślesak, I., Orzechowska, A., Kruk, J. (2017). Réponses physiologiques et biochimiques à un stress lumineux et thermique élevé chez les plantes. Environ. Exp. Bot. 139, 165�. doi: 10.1016/j.envexpbot.2017.05.002

Thompson, A.J., Tor, M., Barry, C.S., Vrebalov, J., Orfila, C., Jarvis, M.C., et al. (1999). Caractérisation moléculaire et génétique d'un nouveau mutant pléiotrope de maturation de la tomate. J. Physiol Végétal. 120 (2), 383&# x2013390. doi: 10.1104/pp.120.2.383

Toledo-Ortiz, G., Huq, E., Rodríguez-Concepci&#n, M. (2010). Régulation directe de l'expression des gènes de la phytoène synthase et de la biosynthèse des caroténoïdes par des facteurs interagissant avec le phytochrome. Proc. Natl. Acad. Sci. ETATS-UNIS. 107 (25), 11626. doi : 10.1073/pnas.0914428107

Toledo-Ortiz, G., Johansson, H., Lee, K.P., Bou-Torrent, J., Stewart, K., Steel, G., et al. (2014). Le module de régulation HY5–PIF coordonne le contrôle de la lumière et de la température de la transcription du gène photosynthétique (régulation de la transcription du gène photosynthétique par la lumière et la température). Génétique PLoS 10 (6), e1004416. doi: 10.1371/journal.pgen.1004416

Ueda, H., Kusaba, M. (2015). La strigolactone régule la sénescence des feuilles de concert avec l'éthylène dans Arabidopsis. J. Physiol Végétal. 169 (1), 138. doi : 10.1104/pp.15.00325

Vallabhaneni, R., Bradbury, L. M. T., Wurtzel, E. T. (2010). La famille des gènes de la caroténoïde dioxygénase dans le maïs, le sorgho et le riz. Cambre. Biochimie. Biophys. 504 (1), 104�. doi: 10.1016/j.abb.2010.07.019

Vardhini, B.V., Rao, S.S.R. (2002). Accélération de la maturation des disques de péricarpe de tomate par les brassinostéroïdes. Phytochimie 61 (7), 843&# x2013847. doi: 10.1016/S0031-9422(02)00223-6

Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R., et al. (2002). Un gène MADS-box nécessaire à la maturation des fruits au locus de l'inhibiteur de maturation de la tomate (rin). Science 296 (5566), 343&# x2013346. doi: 10.1126/science.1068181

Vrebalov, J., Pan, I.L., Arroyo, A.J.M., Mcquinn, R., Chung, M., Poole, M., et al. (2009). L'expansion et la maturation des fruits charnus sont régulées par le gène SHATTERPROOF de la tomate TAGL1. Cellule de plante 21 (10), 3041&# x20133062. doi: 10.1105/tpc.109.066936

Wang, J., Czech, B., Weigel, D. (2009). Les facteurs de transcription SPL régulés par miR156 définissent une voie de floraison endogène dans Arabidopsis thaliana. Cellule 138 (4), 738&# x2013749. doi: 10.1016/j.cell.2009.06.014

Wang, W., Liu, G., Niu, H., Timko, M. P., Zhang, H. (2014). La protéine F-box COI1 fonctionne en amont de MYB305 pour réguler le métabolisme des glucides primaires dans le tabac (Nicotiana tabacum L. cv. TN90). J. Exp. Bot. 65 (8), 2147�. doi: 10.1093/jxb/eru084

Wang, X., Yamagishi, M. (2019). Les mécanismes supprimant l'accumulation de caroténoïdes dans les fleurs diffèrent selon les groupes hybrides de lys (Lilium spp.). Sci. Hortique. 243, 159&# x2013168. doi: 10.1016/j.scienta.2018.08.025

Wei, S., Yu, B., Gruber, M. Y., Khatchatourians, G. G., Hegedus, D. D., Hannoufa, A. (2010). Augmentation des niveaux de caroténoïdes des graines et de la ramification dans les transgéniques Brassica napus exprimant le Arabidopsis gène miR156b. J. Agric. Chimie alimentaire. 58 (17), 9572&# x20139578. doi: 10.1021/jf102635f

Welsch, R., Medina, J., Giuliano, G., Beyer, P., von Lintig, J. (2003). Caractérisation structurale et fonctionnelle du promoteur de la phytoène synthase de Arabidopsis thaliana. Plante 216 (3), 523&# x2013534. doi: 10.1007/s00425-002-0885-3

Welsch, R., Maass, D., Voegel, T., Dellapenna, D., Beyer, P. (2007). Facteur de transcription RAP2.2 et son partenaire d'interaction SINAT2 : éléments stables dans la caroténogenèse de Arabidopsis feuilles. J. Physiol Végétal. 145 (3), 1073&# x20131085. doi: 10.1104/pp.107.104828

Welsch, R., Wust, F., Bar, C., Al-Babili, S., Beyer, P. (2008). Une troisième phytoène synthase est consacrée à la formation d'acide abscissique induite par le stress abiotique chez le riz et définit la diversification fonctionnelle des gènes de la phytoène synthase. J. Physiol Végétal. 147 (1), 367&# x2013380. doi: 10.1104/pp.108.117028

Weng, L., Zhao, F., Li, R., Xu, C., Chen, K., Xiao, H. (2015). Le facteur de transcription à doigt de zinc SlZFP2 régule négativement la biosynthèse de l'acide abscissique et la maturation des fruits chez la tomate. J. Physiol Végétal. 167 (3), 931&# x2013949. doi: 10.1104/pp.114.255174

Wu, W., Liu, L. L., Yan, Y. C. (2019). TERF1 régule l'expression des gènes nucléaires par le biais de signaux rétrogrades chloroplastiques. Russ. J. Physiol Végétal., 66 (1), 22&# x201328. doi: 10.1134/S1021443719010205

Xie, Q., Hu, Z., Zhu, Z., Dong, T., Zhao, Z., Cui, B., et al. (2014). La surexpression d'un nouveau gène MADS-box SlFYFL retarde la sénescence, la maturation des fruits et l'abscission chez la tomate. Sci. représentant 4, 4367. doi : 10.1038/srep04367

Xiong, C., Luo, D., Lin, A., Zhang, C., Shan, L., He, P., et al. (2019). Une protéine B-box de tomate SlBBX20 module la biosynthèse des caroténoïdes en activant directement PHYTOENE SYNTHASE 1, et est ciblée pour la dégradation médiée par le protéasome 26S. Nouveau Phytol. 221 (1), 279�. doi: 10.1111/nph.15373

Yamagishi, M., Kishimoto, S., Nakayama, M. (2010). Composition en caroténoïdes et modifications de l'expression des gènes de biosynthèse des caroténoïdes dans les tépales du lys hybride asiatique. Race végétale. 129 (1), 100�. doi: 10.1111/j.1439-0523.2009.01656.x

Yamamizo, C., Kishimoto, S., Ohmiya, A. (2010). Composition en caroténoïdes et expression des gènes caroténogènes au cours Ipomée développement des pétales. J. Exp. Bot. 61 (3), 709&# x2013719. doi: 10.1093/jxb/erp335

Yang, J.C., Zhang, J.H., Wang, Z.Q., Zhu, Q.S., Liu, L.J. (2003). Implication de l'acide abscissique et des cytokinines dans la sénescence et la remobilisation des réserves de carbone chez le blé soumis à un stress hydrique lors du remplissage des grains. Environ de cellules végétales. 26 (10), 1621&# x20131631. doi: 10.1046/j.1365-3040.2003.01081.x

Yuan, H., Zhang, J., Nageswaran, D., Li, L. (2015). Métabolisme et régulation des caroténoïdes dans les cultures horticoles. Hortic Res. 2, 15036. doi : 10.1038/hortres.2015.36

Zhang, B., Liu, C., Wang, Y., Yao, X., Wang, F., Wu, J., et al. (2015). La perturbation d'un gène CAROTÉNODE DE CLEAVAGE DIOXYGENASE 4 convertit la couleur de la fleur du blanc au jaune dans Brassica espèce. Nouveau Phytol. 206 (4), 1513&# x20131526. doi: 10.1111/nph.13335

Zhang, J., Hu, Z., Yao, Q., Guo, X., Nguyen, V., Li, F., et al. (2018a). Une protéine MADS-box de tomate, SlCMB1, régule la biosynthèse de l'éthylène et l'accumulation de caroténoïdes pendant la maturation des fruits. Sci. représentant 8 (1), 3413. doi : 10.1038/s41598-018-21672-8

Zhang, M., Yuan, B., Leng, P. (2009). Le rôle de l'ABA dans le déclenchement de la biosynthèse de l'éthylène et de la maturation des fruits de la tomate. J. Exp. Bot. 60 (6), 1579&# x20131588. doi: 10.1093/jxb/erp026

Zhang, Y., Li, Z., Tu, Y., Cheng, W., Yang, Y. (2018b). Tomate (Solanum lycopersicum) SlIPT4, codant pour une isopentényltransférase, est impliqué dans la sénescence des feuilles et la biosynthèse du lycopène au cours de la maturation des fruits. BMC Végétal Biol. 18 (1), 107. doi : 10.1186/s12870-018-1327-0

Zhong, S., Fei, Z., Yun-Ru, C., Zheng, Y., Huang, M., Vrebalov, J., et al. (2013). Les méthylomes de résolution à base unique du développement du fruit de la tomate révèlent des modifications de l'épigénome associées à la maturation. Nat. Biotechnologie. 31 (2), 154. doi : 10.1038/nbt.2462

Zhou, X., Welsch, R., Yang, Y., Alvarez, D., Riediger, M., Yuan, H., et al. (2015). Arabidopsis Les protéines OR sont les principaux régulateurs post-transcriptionnels de la phytoène synthase dans le contrôle de la biosynthèse des caroténoïdes. Proc. Natl. Acad. Sci. ETATS-UNIS. 112 (11), 3558&# x20133563. doi: 10.1073/pnas.1420831112

Zhou, D., Shen, Y., Zhou, P., Fatima, M., Lin, J., Yue, J., et al. (2019). La papaye CpbHLH1/2 régule les gènes liés à la biosynthèse des caroténoïdes pendant la maturation du fruit de la papaye. Hortic Res. 6 (1), 80. doi : 10.1038/s41438-019-0162-2

Zhu, F., Luo, T., Liu, C., Wang, Y., Yang, H., Yang, W., et al. (2017a). Un facteur de transcription R2R3-MYB réprime la transformation des caroténoïdes à branches α et β en régulant négativement l'expression de CrBCH2 et de CrNCED5 dans les flaves de réticulés d'agrumes. Nouveau Phytol. 216 (1), 178�. doi: 10.1111/nph.14684

Zhu, J. (2002). Transduction des signaux de stress salin et de sécheresse chez les plantes. Annu. Rév. Plant Biol. 53 (1), 247�. doi: 10.1146/annurev.arplant.53.091401.143329

Zhu, L., Bu, Q., Xu, X., Paik, I., Huang, X., Hoecker, U., et al. (2015). CUL4 forme une ligase E3 avec COP1 et SPA pour favoriser la dégradation induite par la lumière de PIF1. Nat. Commun. 6, 7245. doi : 10.1038/ncomms8245

Zhu, M., Chen, G., Zhou, S., Tu, Y., Wang, Y., Dong, T., et al. (2014). Un nouveau facteur de transcription NAC de tomate (NAM/ATAF1/2/CUC2), SlNAC4, fonctionne comme un régulateur positif de la maturation des fruits et de l'accumulation de caroténoïdes. Cellule végétale Physiol. 55 (1), 119&# x2013135. doi: 10.1093/pcp/pct162

Zhu, Q., Zeng, D., Yu, S., Cui, C., Li, J., Li, H., et al. (2018). Du riz doré à l'aSTARice : bio-ingénierie de la biosynthèse de l'astaxanthine dans l'endosperme du riz. Mol. Plante 11 (12), 1440&# x20131448. doi: 10.1016/j.molp.2018.09.007

Zhu, Z., Chen, G., Guo, X., Yin, W., Yu, X., Hu, J., et al. (2017b). La surexpression de SlPRE2, un facteur de transcription de bHLH atypique, affecte la morphologie de la plante et l'accumulation de pigments de fruits chez la tomate. Sci. représentant 7 (1), 5786. doi : 10.1038/s41598-017-04092-y

Zhu, Z., Li, G., Yan, C., Liu, L., Zhang, Q., Han, Z., et al. (2019). DRL1, codant pour un facteur de transcription NAC, est impliqué dans la sénescence foliaire de la vigne. Int. J. Molé. Sci. 20 (11), 2678. doi: 10.3390/ijms20112678

Mots clés : biosynthèse des caroténoïdes, régulation transcriptionnelle, tissu photosynthétique, fleurs, fruits, graines, racines

Citation : Stanley L et Yuan Y-W (2019) Régulation transcriptionnelle de la biosynthèse des caroténoïdes chez les plantes : autant de régulateurs, si peu de consensus. Devant. Plante Sci. 10:1017. doi: 10.3389/fpls.2019.01017

Reçu : 17 mai 2019 Accepté : 22 juillet 2019
Publié: 09 août 2019.

Manuel Rodriguez-Concepcion, Centre de recherche en génomique agricole (CRAG), Espagne

Gianfranco Diretto, Énergie et développement économique durable (ENEA), Italie
Gabriela Toledo-Ortiz, Université de Lancaster, Royaume-Uni

Copyright © 2019 Stanley et Yuan. Il s'agit d'un article en libre accès distribué sous les termes de la Creative Commons Attribution License (CC BY). L'utilisation, la distribution ou la reproduction dans d'autres forums est autorisée, à condition que le ou les auteurs originaux et le ou les titulaires des droits d'auteur soient crédités et que la publication originale dans cette revue soit citée, conformément à la pratique académique acceptée. Aucune utilisation, distribution ou reproduction non conforme à ces conditions n'est autorisée.


Voir la vidéo: biosynthesis of carotene and carotenoids. carotene and carotenoids. by Dinesh nain sir (Janvier 2022).